GenePrediction:GLEAN_3904 Details

Name: GLEAN_3904
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1589827..1590672 (+ strand)
Length: 846
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1589827..1589898 (+ strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_113:1589950..1590013 (+ strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_113:1590086..1590672 (+ strand)
Length: 587
>GLEAN_3904 class=GenePrediction position=GCSC_113:1589827..1590672 (+ strand)
ATGGCCGATGGAGCACCGAAGCCGAGCAGCAGCGTGAAGCTTGTTCTGCTGGGCGAAGCCGCTGTTGGAAAGGTCAGCCT
AGGGTGATATCGCACGGTGCGACTGTGGCTAACTCTGGTGCAGTCTTCGCTGGTCCTGCGATTTGTGAACAATGACTTCC
AGGAGAACAAGGAGCCAACGATTGGAGGTGGGTCTCGCTGATGCTTCCGGTGCCTTGCTTTGCCGCGTGGGGGCGCCTCG
GTCTTGCTGACAGCTACAGCCGCCTTTCTGACGCAAAAATGCAATCTGCCAACGCGAACGATCAAATTTGAGATATGGGA
CACGGCCGGCCAGGAACGGTTCGCCTCGCTCGCCCCGATGTACTACCGCAATGCCCAGGCCGCGCTGGTGGTGTACGACC
TGACTAAGCCGACGTCCCTGATCAAGGCGAAGCACTGGGTGGCCGAGCTGCAGCGCCAGGCATCACCGGGAATCGTCATC
GCACTGGTCGGCAACAAGCTGGATCTGACGGACAGCGGCGGCGCGGCGACGCCAAACCCAGATGCCGAGGCCGGCGACGA
AGCCGAGAGCACGGACGCGCGCAAGGTCAGCACGGAAGAGGCCCGGACATATGCGGACGAGGAGAGCCTGCTGTTCTTCG
AGACCAGCGCCAAGACCGGCACCAACGTGGCCGAGGTCTTTACGGCAATCGCAAACGCCATTCCGGAGACGTCGCTCAAG
AGCGCCCGGGGAGGCGTCGGCGGCGCTGCCGGAGCCGGTGCTCGAGCTGGTGGCGGTACCGACGGCAACCGCGTGAATCT
GCACGGCGCGCGGGATCAGGGCGCGAAGGAGGGTTGTGCCTGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62