GenePrediction:GLEAN_3906 Details

Name: GLEAN_3906
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1592800..1593824 (+ strand)
Length: 1025
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1592800..1592917 (+ strand)
Length: 118
Type: CDS
Source: GLEAN
Position: GCSC_113:1592980..1593824 (+ strand)
Length: 845
>GLEAN_3906 class=GenePrediction position=GCSC_113:1592800..1593824 (+ strand)
ATGGCCGATATCAACCTCCAGGACGTGCACGACACGTTGGTGGCAATCGCCTTTGAGGCTGGGAGCAAGATTCTTGCAGC
CGACCCCAACAACATTCCCAAAGGAACGAAGCTGAACTGTGAGGCGCCTTTTACTTCTTTCCCTTCTCTCTTCTGTCAGC
ACGCTAACAGCCGGCGAAAGCGGTCGACCTCGTGACGGAGGCAGACCAGGCCGTCGAGCGGCTAGTGTCGACGAAGCTGC
GGGAAAAGTACCCCGACTTTGACTTTGTCGGCGAAGAAACATATGTGGCTGGCGAGACGCGGGTGACGGATGCGCCGACG
TTTGTGGTGGACCCGATCGACGGTACGACCAACTTTGTTCACGGCTTTCCGCACGCATGCATCAGCCTGGGCTTTGCCGT
TGGCCGGCAGCCGGCGGTCGGCGTCGTCTACAACCCCTTTCTCGACACGCTGTACTCGGCCGTGCAGGGCGGCGGCGCCT
TTATGCAGCGCAACGCCTCGCTGGCCCGCGACGACAGCATCGACAGCAGTCTGCGCAGCCGCATCAGCAGCCGCCAGCAG
CTGCCGCTGGTCGGCCGCGGCGACAGTGCTTCCGCGCCGCCGCTGCATGGTCTCGGCACCGCTCTCGTGGCCGTCGAATG
GGGCTCCGATCGCCAGGGCGCCAACTTTGACATCAAGGTCGAGACATACCGCCGCCTCGCTGCCGCCACCGAGCCGAACA
CGCCCAATGCCATGGTCCACAGCCTGCGCTCTCTCGGCTCGGCCGCGCTCAACCTGTGCGCCGTCGCCACCGGCCAGCTC
GACGCCTACTGGGAGGGCGGCTGCTACGCCTGGGACGTCTGTGCCGCCTGGTGCATCCTGACCGAGGCTGGCGGCATCAT
GGCTAGCGGCAATTCCGGCTGCTGGGACCCGGCTCTGGACAGCCGGGTGTATCTGGCCGTGCGTGGCGCGCCAGCAGGTC
AGCGGGCCATTGTCGAGGAGCTCTGGGGCGTTCTCGGCGACAGCAAGATCGTGTACAAGCACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62