GenePrediction:GLEAN_3907 Details

Name: GLEAN_3907
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1595015..1596902 (+ strand)
Length: 1888
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1595015..1595090 (+ strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_113:1595146..1595511 (+ strand)
Length: 366
Type: CDS
Source: GLEAN
Position: GCSC_113:1595572..1596902 (+ strand)
Length: 1331
>GLEAN_3907 class=GenePrediction position=GCSC_113:1595015..1596902 (+ strand)
ATGAGCCTAATCAAGCCAAAGCCAAGATGTTCTCGCGATCCTGATGCTTTCCCCATCTTCCAACTGTTCATTCTCGGTAA
GAGATCGTACCAAGGGCTGATCGGAGGAGACAACGTATGCTAACTCGATAGCTATTGTCCGCCTTGCGGAGCCCATCGCC
CTCACCTCCATCTTCCCATATGCTTGGGCCTTGATCAAGCACTTCCAAATCGGCCAGGAGAGCGATGCATCCTTCTATGC
CGGCGTCCTCATATCGGCCTTCTCCCTGGCGGAGGCCATGATGGGAATGTACTGGGGCGGCCTCTCAGACCGAATTGGCC
GCAAGCCTGTCCTCCTTGTCGGTTGTGTGGGCACCATGTTCAGCATGATTGCCGTGGGCCTGGCGCCCAACATCTGGGTG
GCTCTCGCGGGACGGGCGGCTGGGGGCTTCCTGAACGGCAACATTGGCGTCATCCAGACCATGGTTGGCGAGCTGGTAAC
GAAACCAGAACATGAGCGTAAGTGTCGACGTATCTCACCTGTCTTCGCGTAGGCTTACGTCAGTTAACACCATGCAGCTC
GTGCGTATGCCATCATGCCGTTTGTCTGGAGCATCGGTACCATCATAGGTCCGGCCATCGGCGGCACGTTTTCCGATCCT
CGCGCCTCGTTCCCCGGCGTCTTTTCGGAGGGCTGCCTGTTCGACCGATTCCCCTTTCTACTGCCGAACCTGGTGTGTGC
TCTGCTGCTTTTCATCAGCATCGTGCTCGGCTACTTCCTCCTCCAGGAGACCCATCCCGACCTGCAGCACAAAGCCGACT
GCGCGCCGGCAGACAATATCTTGAGCCCTGTTCTGCAGCACCACCAGCACGATGTTTACATGTCGTTTGAGACACCGCTG
CTGGAGACGTCGGACGCGCTGAAGCGACCGGCCGTCGACGTGCGCACGGATATGTACGGAACATTCCAACGGGGCCGTGG
CAGCCAGTGGGAGGCCGAAGGAAGCAGCTCGGCCGAATCGTCGACGGTGTGCTCCAGTAGGAGCAGCAGCAGCACCAGCC
TCAACAAATACTTTGCGGAAAAGAAGAAGAGGAGCTTGCAGGCGTGTCCACCGGTCAGCATCTTCTCACGCCGAATCATG
GCCGTGGTCCTGGCCCTCGCCATCTTTACGTACCACAGCATGGCCTACGACTCGACGCTGCCGGTCTTCTTTGAGGACGA
CCGGGTGCTACCGTTTCCTGGCAGCGGTGGAAGCGGCGGCGACAACAGCACCCAATTGCCCTCGTTTCCAGCTATGCTCT
TCTACTCGCCGGGCGGGCTCGGCCTGTCCCTGCGCAGCGTGGGCATGATCATGGCCGTAGACGGGGCGATTGCGCTGTTC
GTGCAGGCGGTGGTGTTCCCGCTAGCTGCAGCGTGGATGGGCGTGTACCAGCTGTTCATCGTTGCGACGGTGCTGCATCC
GCTGGCTTACATGCTGTTGCCATGCCTGCTGTACGTGCCGGCCTGTCTGTTGTACCCGGCCATTTATGCGTGCATGGCCG
TACGGACGGTGTTTGCCATCATCATCTATCCTCTGCTGCTGATCCTGATCAAAGAGGCGACACCGAGCGCGTCGATTCTA
GGCAAGGTCAACGGGTTGGCAGCCAGTGCGGGTGCGGCCTGCCGCATGATTGCGCCGCCCATTGCGGGCTACCTGTATAC
AGTGGGCAGCCGGATGAACTGCACGGCACTGGTGTGGTACAGCGGCGTGGTGGTGGCGCTGATAGGCGCGGCGCAGTGCT
TCAGCGTGGCGAGGCCACGGGACAGGCTGCAGACGGAACCGCAGGCGGATCCGGAAGCAGAGCTTTCCATAGAGTCGGCA
GAGGTGGACGAGGATTTTTATAGCATGCGCAGCGAGGATGACTTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62