GenePrediction:GLEAN_3909 Details

Name: GLEAN_3909
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1605505..1610976 (+ strand)
Length: 5472
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1605505..1605573 (+ strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_113:1605682..1606359 (+ strand)
Length: 678
Type: CDS
Source: GLEAN
Position: GCSC_113:1606427..1609165 (+ strand)
Length: 2739
Type: CDS
Source: GLEAN
Position: GCSC_113:1609233..1609496 (+ strand)
Length: 264
Type: CDS
Source: GLEAN
Position: GCSC_113:1609552..1610976 (+ strand)
Length: 1425
>GLEAN_3909 class=GenePrediction position=GCSC_113:1605505..1610976 (+ strand)
ATGGACTCCGATATGGATGACTCCGTCTTTGACGTCAACAACGACTCCGAAGGCTATTCGCCCGAGCCGGTAAGGCCAGA
CCTCCAGCCATAGATATCATGGAATGGGCATATATAGATCTCGAAGATCAGGGCAATCCCACGATGGTTTAGACTAATGC
TGAGGTTGTTTACATAGAAGCCCAAGGCAAAGGCACCCCCCAAGAAAGCTGCCGCACCGAGAGCACCAAAGGCAGCACCA
AAGCCCAAGGCAGCTCCCAAGAAAGCGACAAAACTCGTCCAGACGAAGCTGGGTGCAAAGCCTGCCGCGGCCAAGAAACG
GCCAGCGCCCCCGAGCGACGACGATGACGATGCCGTCGACTTGGACGACAACAGTGCCGTCAGCACCCTGTCGCAAACAC
CGCCCAGCGCCAAGAAAAAAGCGCCGGCCAAGAAGGCCAAGTCGGCTGGCAAGCCGCTGGCCGAAATTGCCAACGACAGC
AGCATGACCCAGCTCGACGGCGTCGACGACGAGCCGGCCTCACAGGCTGCCGGGTCTAGCAAGACCGCATCCGAGATGTA
CCAGAAATTAACACAACTCGAGCACATCATCAAGCGTCCCGACACTTACATCGGCTCTGTCGAGCACGCCGAGCAGCTGA
TGTGGGTATACAACAAGGCGACCGGCCAGATGGAGAAGCGAGCAATATCGTTCGTGCCCGGCCTGTACAAGATTTTCGAC
GAGATCCTCGTAAACGCTGCCGACAACAAGCAGCGCGACCCCAGCATGTCAATGCTCAAGGTCACGGTGGATCGCGCCGC
CGGCGAGATCAGCGTCGAGAACAACGGCAAAGGTATCGCCATTGAAATGCATCAGGTAGGCCCTAATCTGAACCACGATC
GAGACACTTTCAGGTCACTCACACGCTCGCTCTCTCTTGCAGAAAGAGAAGGTCTACATTCCAGAGCTGCTGTTCGGCCA
CCTCCTCACTGGTTCCAACTACGACGACAACGAAAAGAGAACCGTTGGTGGCCGGAACGGTTACGGTGCGAAGCTGTGTA
ACGTCTTTTCCACTGAGTTCACGGTCGAGTGCCAGGATTCGGCCAGTGGAAAGCGCTACAAGCAGACATGGCACAACAAC
ATGTCCGTCATGGACAAGGCGAGGATTACGGCCAACAAATCCTCCGATTTTGTCCGTGTGACCTTCAAGCCCGACTTCGA
GCGCTTCGGCATGCCAAATGGCATCGACGACGACCTCGAGGCCCTGATGTACCGCCGTATCTACGATATGGCGGGTGTCG
TGGATGGCGTCAAGGTCTTCTTGAACGGCGAGTACCTTAAGGTCGGCTTCAAGAAGTATTGCGACATGTACGCAAAGGCC
ATTGCCAAGGAGCGCGATGAGGAGGTGACTGGTGAAGAGCTGCCCCCGGCTGCCACCGTGCAGTTTGAGGATCCCAAAGC
CCACAAGCGCTGGCAGATCGGCTTCACCGTGTCCGACGGCACGTTTCAGCAGGTCTCGTTTGTCAACTCCATTGCCACCA
CGTCGGGAGGCACTCACGTCAACTACATCGCCGACCAGATCTGCAATGCCCTGCTGGCCGACCTCAACAAGCGCAAGAAG
GGCCATTCGCTGAAGCTGAACCACATCCGCAACCACATCTTCATCTTTGTCAACTGCTTCATCGACAACCCGGCCTTCAC
CGGCCAGACAAAGGAGCAGATGACCACCAAAGTTAGCGCTTTTGGCACCAAGTGCGTTCTGACGGACGCCTTCATCAAGA
AGATCCGCTCCACCGACGCTATCAACAATATCATCCACTTTGCCGAGAAGAAGGCCGACAAGATGATGTCGAAGAGCGAT
GGAAACAGACGCTCCCGTATCAGCAACGATAAGCTTGTCGATGCTAACTTGGCCGGTACCAAGCACGGCCACGAGTGCAC
TCTGATCCTGACAGAGGGTGATTCCGCCCGTGGCTTGGCCATCGCAGGTCGTGCCGTTCTAGATCCTGATCGCATCGGTG
TCTTCCCTCTGCGTGGTAAACTTCTAAACGTGCGCGATGCGTCCATCGACCAGATCACCAAGAACAAGGAGATTCAAAAC
ATCAAGCAGTTCCTCGGCCTGAAGCACAAGCAGGTGTATACCGATACAAAGAGCTTGCGCTATGGACATCTGATGATCAT
GGCGGATCAAGATCACGATGGTAGTCATATCAAGGGCCTGCTCATCAACTTTTTGCAGGTCCAGTTCCCATCCCTGCTGT
TGATTCCCGAGTTCTTTCAAGAGTTTATCACCCCGGTGGTGAAGGTCTGGCAGGGCCCCAACCCGAAGAAGCCGACCAAG
TCCAAGGCGTTCTATACCATCCCAGAGTACGAAGAGTGGAAAGATGCACACCACTCGGAAGTCAAGCGATGGGAGCACAA
GTACCTCAAGGGTCTGGGTTCCAGTTCCAACGAGGATGCTCAAGTGTACTTTACCAATCTGGACGCTCACTTGAAGGAGT
TTGAAACCATGCAGACCGACGAGGCCCAGCTGTTTGACCTGGCCTTTTCGAAAAAGAAGGCCGATGCTCGGAAAGAATGG
CTGGGCAACTTCATTCCAGGCACGTTCCTGGACCAGTCGACAAAGAGCATCACCTACTCGGATTTTGTCAACAAGGAGTT
GATCCTGTTCAGCATGGCTGACAACATGCGCTCAATCCCGTCTGTCGTTGACGGACTCAAGCCCGGTCAGCGCAAGGTTA
TCTACACGTGTCTGAAGAAGAACATTGTCAAGGACCAAAAGGTGTTTGAGTTGGCCGGTTCGGTCTCCAAGCTGGCTGCT
TACCATCACGGTGACGCGTCGCTGCACCAGACCATTGTCGGTCTGGCACAGAACTTTGTCGGCTCCAACAACATCAACTG
TCTGGAGCCCAGCGGTAATTTTGGTTCTCGTCTATCCGGTGGCTCCGACGCTGCTAGTGCTCGATACATTTTCACCCGTC
TGTCGCCCTTTGCTCGCCGTGTGTTCAATCCTCTTGACGAACCCGTCCTCGAGAACAACATTGATGAGGGCAGCGTTATC
GAGCCGAAGAACTACGCCCCCATTGTCCCCATGGTTCTGATCAATGGTGCCGATGGTATCGGCACTGGCTGGAGCACATC
TATTCCCAACTATAATCCTGTCGACGTCGTCAACAATCTGAAGCGGCGAATGGGCCGACTTGCTGGTCACGAAAACGAGG
AGCTGCCCTTTGAGTCGATGATCCCCTGGTTCCGCGGCTGGAAAGGAACACCTGAGCCGGATAGCGTGCCGGGGAGGTAT
CGGTTCAACGGAATTATCTACCAGGATGACAGGAACCCCAACGAGATTGTGGTGTCCGAACTTCCGGTGCGCATGTGGAC
CGATGACTTCAAAGCCAAGCTGGAGGAGGTGATCCGTGCCGAGAAGTCGCCGTCGTGGATCAAGGACTACAAGGAGTTCA
ACGACCATCGGAACGTACACTTTGTCATCCAGATGGAAGACAAGCATGTGCAGGCAGCCGTTGACGAAGGCTTGATTGAT
CGTTTTAAGCTCAGCAAGACGGTCGGCACAACAAACCTGGTGGCTTTCGATATCAATGGCCAGATTCGCAGATACGAGAA
AGTGGAAGACATCCTGGAGGAGTTCTTCAACTACCGGCTCAACATGTATGGCCTACGCAAGGTATGTTTCGCGATGGCTT
CCTGCTCTGTTTGCTGAAAAGGCCTGAGACATGTGCTGACATTAATAGAAACACTGGCTCGGCGTGTACCACACCGAATT
CCGTAAACTGAACAACCAGTATCGCTTCGTGCAGGAGATCATGGATGGAAAGCTCGTGGTGTCGAAGAAGAAGAAGGATG
TTGTTGTGGAGGAACTCCGAGCGCGCAGTTACGAAGCCTTCCCGAAGGAGTCCAGCGACCCGAAAAAGGCCAAGACAAAA
GACGACGACGACAACGAGGATGAAGATGAAATAGATGGCGGAACAGCCCGCGACTACGACTATCTTCTTTCGGTATGCAT
ATGTCCGGGATCATTATGTATACCAGACGCAGAAGCTGACTTTATAGATGCCCATCTGGTCTTTCACCCAGGAGCGCCTG
GACAGACTGAAGAAGCAGATCGATGCGAAGAAGGCGCAGTATGATGAACTTGACGTAAAGAGCGAGAAGGACCTGTGGTG
CTTTGATCTAGACGAGTTCTTGGCTGAATGGGAGAACCAGCTGCAACTGGACTCCGAGATTCAAACTACGATCCGCCGCA
TGGGCCGCCGCACGTCCAAGAAGATCGGTGCTGGACGCGGCCGCAAAGCGCGTGCCGACGACGAGTATACAGACAAAAAG
CCAGCACGTGCTCCAAAGGTAGCTGCGATGAAGGCTGTTACCGCCCCGAAGCCGTTGGAGAAGACGTCGCAGCGTTTTGC
CGAAATGTTTTCTGCCAAGCCCAAAGCCAAACCGACCAGCCAGAAGATGAGTGTGGATGGCGCTGAGGACGACTTCTCTG
ATGACGATTTTGCGGCATTGGCGAAGCCACGGTCAAAGAATTCGGTCATAGCGGCGATCAAGGATGACGAGGACGATAAA
GATGGCGTGGACATGGAGCTGCCGTCCGCGATAATGAAGAGCGATATCGCAGGCGGCGGGCGGACAAAACGTGCAGCGGC
CACAAGGGCGAAAAAGTGGACCATTGACTCGGACTCAGAATTGGAGGATGATGACGAGGAGATGTTGGGCGACGTTGGGG
CCATGGTCAAGGGCATTGGCCAGCAACAGCAACAACCGCCTGGATCATCCAGTGGTGGCCGGCTTAGCCTGTTTGCGATG
TCACGTCCGGAAACCGGCGACAGCAGCATTAGCGGAGTCAGCTCCACCCTTCCAAAGACGACACGGCCAAAGTCTTCATC
AAAGACGTTTGATTTTGACAGCCACGATGATACCAACTATGAGGCTCTCGCTCTCTCGTCTCCACGCAAATCGACCAAAG
CAGACGAGGTTGATGAACTGCTTTCCGACGACGACGATGTCCGAACGGCGGCAGGGAAACCAGCGACAACAAACGCCCCG
TTGAACGTGGTTCCGACCCTGGCCAAAAAGGGTCGTGGTCGGCCAGCGGGGGCCAAGAGCAAGGCCGGCAGCGAAAAGAA
GGATGTGGAAGACGCCAAGACAGGACTGTCTCCAGCTGCCAAGGCATACGTTGCGAAGATGGCAAAGGCCAAGGCGGCGC
TCTTCCTGAGCGACGATGACGACGATGACGATGACGATGTTGTGGTTCGGAAGAGGCCAGCACCAAAGGCCACAACCAAG
ACCACCAAAACAGCCAAGGCAGCCACCACGGCGAAAACGTCCAAGGTAGCCACCACGGCGAAGACGGCCCGGCCGGCACG
CGTTACTGCTGCATCAAAGAAGAAGCCTGTGTACATTGACGACGACGAGGATGATTCAATGGTGTTCGAGGCCCCCGATG
AAAGCGACGATTTTGACATGGACTCTGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62