GenePrediction:GLEAN_390 Details

Name: GLEAN_390
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1481197..1486560 (+ strand)
Length: 5364
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1481197..1481370 (+ strand)
Length: 174
Type: CDS
Source: GLEAN
Position: GCSC_167:1481446..1481580 (+ strand)
Length: 135
Type: CDS
Source: GLEAN
Position: GCSC_167:1481644..1481673 (+ strand)
Length: 30
Type: CDS
Source: GLEAN
Position: GCSC_167:1481754..1481818 (+ strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_167:1481881..1482319 (+ strand)
Length: 439
Type: CDS
Source: GLEAN
Position: GCSC_167:1482377..1482725 (+ strand)
Length: 349
Type: CDS
Source: GLEAN
Position: GCSC_167:1482796..1483952 (+ strand)
Length: 1157
Type: CDS
Source: GLEAN
Position: GCSC_167:1484006..1484149 (+ strand)
Length: 144
Type: CDS
Source: GLEAN
Position: GCSC_167:1484207..1485150 (+ strand)
Length: 944
Type: CDS
Source: GLEAN
Position: GCSC_167:1485215..1486159 (+ strand)
Length: 945
Type: CDS
Source: GLEAN
Position: GCSC_167:1486410..1486560 (+ strand)
Length: 151
>GLEAN_390 class=GenePrediction position=GCSC_167:1481197..1486560 (+ strand)
ATGCCTGGCACCCCGCGGAGATCGGAAGCCAGGGATGCTCAGTACAACAGCGGCAGCATCGGTGTCCCGCAGTCTACAGC
ATCGGCCCCGACACCTGCCTCTCGAAAATCCGCCTCGAGCAGCAACATGCGGGACCGATCCGGAGCACTGCAAGACCCTG
GGCTGAAAGACTACGTGAGTGACTGCGGGGACCGGAGAGATTCTCTGCTTGTCTTGACAACCTAGGAAACAGCTAGCTGA
CAAGGCCAGCGTCTGGGTGACTGTATCGGCAAAGGTGCCTTCGGCTCCGTCTACAAGGCATTCAACTGGGGCACAGGTGA
GGCCGTGGCGGTGAAGCAGATAAAGCTGACCAACGTGCCCAAGAGCGAGTTGCGCATGATCGAGGTACAGTGACCCTCCA
TCCCCACTCAGTAAGGCGAGCCTGACTAATGACGCAATCCTACCCAGGCCGAAATTGACCTGCTGAAGAACCTCCATGTA
CGTGTTGAAGAATACACCGGCGGGAGGGAGGACAGAAGCCGGTGTAGGCTGTGTTGACTAATCTGTGCGATATTCAGCAC
GACAACATTGTCAAGTACATTGGCTTCGTCAAGTCCACCGACTGTTTAAATATCATTCTCGAGTGCGTCTTCTCCGTATG
GACTTTCCCCGAGGCTGCTTCCGCTTACACTGCAACTACCCTAGATACTGCGAAAACGGCTCCCTGCATTCAATATGCAA
AGCTTACGGCAAGTTTCCCGAAAATCTCGTGGGCGTATACATGACGCAGGTGCTTCAGGGCCTGCAGTACCTACACGACC
AGGGCGTCATTCACCGCGATATCAAGGGTGCCAATATTCTCACCACCAAGGATGGCACCGTCAAGCTGGCCGACTTTGGC
GTCTCCACAAACACTCTCGGTGGTCCGGACAAGGAGGCCCAGGTAGTCGGTACACCCTACTGGATGGCACCGGAAATCAT
CCAGCTTTCTGGTGCTACCTCTGCTTCCGATATCTGGAGTGTAGGGTGTACTGTCATTGAGCTCTTGCAGGGTAAACCTC
CGTACCATAACCTGGCTGCCATGCCGGCCCTCTTTGCCATAGTCAACGATGACCACCCACCGTTGCCAGAGGGCGTTTCT
CCTGTAGGTGCTCCCCGCCTTGTTGCTCTCCTTATCTCTCAAGATATCTGACATGTATAGGCCGCCCGGGACTTCCTCAT
GCAGTGCTTTCAGAAAGACCCCAACCTGAGAGTCTCCGCCAAGAAACTGGGCAGACATCCATGGATCGTTGGTTGTCGGC
GAAGCGACGCTCCTGTTTCAAAAAACCCAACAGAGGCAGTCGAAGAGGTTGTACGCTGGAACCGGGCTTTGGAATCCTCC
GAGACGAACCTGCGGGCATCGACCGGTTCCGACAATAGTTCTGGCCCGCCACAGATGAGCCAGTTCGCCTCGAGGTTCTC
CTCTGTTGAGCAGCAACGGGCGAATCGGCCGCTTTCTCTCAGCAAACCGAGACCAGGTGCGGACGTATTTGGCTCTCCGG
AGCTTCCCGGTACGTCTCTCAGTTCTTACTATGTCTTGACGCTGCTACGAGTTCTAGCTGACAGCAATGCACCTTACAGA
CGAGGACAATTGGGACAATGACTTCGCCACGGCCATCTCGCCCAGCGCCTTGCAAAACCTCAAGCCCCAGGATAACTTTG
GCGGGCTGCTCTCTAGCGACCGTTTGAAACAATTTGCATCTATCGACGAGTGCCGAAATTTGGTCAGCAGCTGGGATGAC
GACTTTACGGAAGGAGAACAGCTTATGACCATCAAGGTCCCAACAGGACAGCTGTCAGAGGTGGACTTCCAGGAGCAGAC
CATCCGCCCACTTCCAAGGCGATCAGACAAGGCGGCCGTCGCTGCGGCCATCGCTGCAGCCATGGCAAATAATGCCGCAT
CGCCACCAGCCAATTACTTAGCAGCATCACCAGCGTCCTCCACGGTCTTCAGCTCGCCGCCATCGGTATCCCCAAAGCCA
ATTCGTCGTCGTAGAACCAAATACGTGTCCTCGGGATCGCACGACCCCTTCTCTGCGCAGAGATCGCCCACCAAAGTTCA
GTTTGGCAACAAATTTGAGCTTCCGTCTCGTCCTGAAATGGCCTACCAGGAACAGCCTGTGGAGGACTACTCGGACTTGC
TCGCCGAAAGCGATCTTGTCTTCACGAACAACCGCCTCAACTTGGTTTTAAACGGTTCCGGGTCTTCGGAGGCACACTCT
ATTGGCCTCCTTCGGTCCTACAGCACACCCCAAGACTCACCTCAGCTGTTCCACCCGTCTGATCTCACAAGTCTTCCACG
GTCTATGCTAGTTCCTCCTAGCGGTAGTATGCGGCGCCAACCACCAACGCGACCCTCTGTATTGCCGGACCGCCCTATGC
GCCGGACACGATCTTCGGTGGAGATTGAGCGCTTTGCCGAAGGCGCTGGAGATGAAGACTTTTCTGATATATTTGGTCCC
AGCGACGACCTCACCGAGAAGGAGGAGAGTGATCGTGGGTCCGACGATGGCGGTCTTATGCTATTGTCCAAGCTATCCCA
CAACTCGTGGCTGGGTGACGAGGAGGACGAGGATGATCCGTTTGCCTTTATGGACCCTGGCTGGGACGAGATGGATCTCG
AGGCGAACATAGCCAGAGACCGTCATGCGCGTCTTGCCGAACGGGTCGAAGAGCTGGTCCGCTCACTCAAAATTGCCAAG
AGTGAAGATGATCTGTCAGAACTTACGGAAGACCTTGTACGCCTGACTCCCATTTCCCCGATTAAAAGGCCTAATACTAA
TGTGACAAGCTCAATCTCCTGTGGGAAAATACGGAAGTCAAGGACTTGATTATCAGTGCACATGGCCTCTTGCCCATTTT
GGAGATTCTTGAGCCTCGCACGGTTAAGAGCCGGCAGCACATGATTCTGCAATTGCTCAAGATTGTCAATGCGGTACGGC
AAACGCGACTTCCCTAATTTTTGCGCACTGTTCCTAACATATGGCGACAGATCATTCTTGATGATGTAGAGCTTCAAGAG
AACTTATGCTTCGTAGGTGGCATTCCTATCGTCACCAAATTTGCGGCTCGACAGTACTCGAACGAAATCCGGCTGGAAGC
TGCCGCGTTTGTGCGGCAGATGTACCAGACATCGACCACAACCCTGCAGATGTTTGTCAGCGCAGGCGGGCTTAATGTTC
TGGTTGAGTTCCTGGACGAGGATTACGATACATCGCGTGACCTTGTTCTGATTGGGGTCAACGGTATCTGGAACGTCTTT
GAGCTGCAAGGGCCAACTCCCAAAAACGACTTCTGCCGCATCTTCTCACGAAGCAAGATCCTCGACCCCCTAGCTCTTGT
GCTGCACAAAGTCTTGGACGAAGAGGACACAGCCATTTCGGAGCTGATCGAGGGCCGCATTGTCAACATATTTTATCTCT
TCTCTCAGGCGGAGAACTACGTTAAGGAGGTTGTGGCAGACCGACAGGTGCTCAAGACAGTGCTGAAGGACTTGACACAC
ATGTCTCCCAACCACCAGATCACGATGCTGAAGTTCATCAAGAACCTGTCCATGCTGTCGACAACGCTAGAGTCGCTTCA
CTCTGCCGATGCCATTGACTTCCTGATCGACGTGCTGAGCCACAGCATGAAAAAGGGCCAGCAACATTTCCGTGAGATCT
CCAACCAGGTCCTCAATACCATGTTTAACCTGTGCCGTCTCAGTAAGGAACGGCAGGAGTATGCGGCTGTCAATGGTATC
ATTCCGCTTCTGCTCAAGATCATGCAGACGGAACGGCCACCAAAAGAGTTTGCACTTCCTATTCTATGCGACATGGCTCA
CTCGGGCAGCAAAGGCAGACGGTATCTGTGGCAAAACAAGGGCCTCGACTTCTACGTCTCTCTTTTGGGAGACCAGTACT
GGCAGGTCACGGCTCTAGATGCCATCTTTATCTGGTAGGTGTCTGCTTGCCTGACTTTCGTATTCTTACCCATGGTGCAT
CTCAATTAACCGATTTAGGCTGCAGGAAGAGACGGCAAAGGTAGAGAGCCATCTCCTGGACGGAAGCCGGTTCCAAGAGG
CCATTGTGGCATGTTTCAATACGACGAAAGCAAATGCGTTTGATTCGAACCTCCTCGAGCCATTGTTGAAAGCGCTTCGC
CTCAGCCCGTCGCTGGCAGCGACTCTGGCCAAGGCAGAGATGTACTCGGGCATTGCGCAGAAACTGAACCACAAGAAGCC
CGTGGTCCGGCTCAATCTCCTACGTCTAGTCCGGAACATCATGGACAACAGCAACGAAAGCATGGCTGGGACCGGACAAG
GTGGCAGCAGCAACGCACATCTTGCCGTTTTGTTCGAAGCCATCCAGATGCTGGCCGAGAAAGACACAGCTGTGTTGGTG
CGCAACCTGGCATCGGAGCTCGTGCGGACTCGCATCGAAGTCGAACACGACAGCACAGCAATCAGCGGAGTGTCGAGTAC
TGCAAGCTCATCGCGATCACGGTCGGGTCCGCATAGGCGCAACACCTTGTACACACCGCCCGGCCTCCAGTCGGCGACCT
CAGCCCCGTTGACACCGACACATGGTGGCGCTCACCACCACCACAGCCACTACAATCAGCACCGCGCGCTGCCACGCCGC
TCTCAGACGTCTCTATCGTCTTCGGACGTAACTTTCATCGAGGTGGCCGCCACACCGAAGCGCTCTGCGCTCGCCCCAAC
ACACGAGCGGGAATCTCTCCTATACCGGCCCCGAAGCCAGGATGGAGGACCGGCTGGCTCGTCGATTCCACGACGTGTTA
GCGGAGAGTCGAGCGGGAGCTCCAAAAGCAGTCTGAGCAGCGGCAGCAGCTTGTCCGCGTCTGGGGGCAGTGCAGGAGGC
CAGGCTGTCGGAGCTATCAAACCACCACGACAGCTTGCAGGCCATGCTAGCCGAACAAGCTTGGGCCCTGCCATCATCAG
CCGGTCCGAAAGCTCACTGCCAATTAAGGACACTGCCAATGGGCGGTATTCGGCAGCTGGCGGTTTGGGGCCGACATTAG
TCCACGGGGCAGAGCGTATCGAAAGGCTAACGGCCCTGGGAAGCGGAATGGGAGGCGGAAGCAACAGCCGGTTTAGTCGA
AGCACTGGAAACAGTGGCAGCGGCCATGGCAGAAGTGGTGGCAGTGGTGGCAGCGGCGGCAGCAGAGTCAGCAACCGGAG
ACGAACACGGCAGCCAAGTGTCGATGCCAAGTGGTCGTAGGGGCACTCTCGGCGGCGGCGGCAACGGAAGGCCGAGGGGC
CAACCACGGCCGGTTGAGTGTGTGATGACGGACGATGACTACGCAATGCCTGATGACAGCGATGAACTGAAGCTATTCCC
ATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62