GenePrediction:GLEAN_3910 Details

Name: GLEAN_3910
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1629269..1633003 (+ strand)
Length: 3735
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1629269..1629365 (+ strand)
Length: 97
Type: CDS
Source: GLEAN
Position: GCSC_113:1629669..1631083 (+ strand)
Length: 1415
Type: CDS
Source: GLEAN
Position: GCSC_113:1631226..1631307 (+ strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_113:1631982..1633003 (+ strand)
Length: 1022
>GLEAN_3910 class=GenePrediction position=GCSC_113:1629269..1633003 (+ strand)
ATGCCCAAGAGACGGCACTGGGCCAAGTACTCAAAGCCGCAGACGACTGCGCCGCACTCTTTGGAGAGCTCCGGCCTCCA
GAGTAACCTCCATCATGGTCTGTCCAATCGCTGCAGCAAACCCGGCCTTTTACTTACATCTATGCCATTTTGGGTATTGT
CCTCCCTCAACGTGCTACCACTCTTACGAGTCCTCATCATGTCTCCTTCTTGCATCTTCTCCCCCTTCTCCCCCTTTCTC
CCTATTCCCACCCCCCTGCTGCTGGCCATCTGTCCTTTTCGTGCTCTCCCAGACCCTTCAAGTCCTCTTTCTTGCTTTTT
GCCACCGGCTTGCAGATTCTCTAGCCTTTTGTGCACCACATGTGTTGGCTGTTATTGCTGATCCATTGACTGTACTTTAG
AAGAACCTCAAACCCGAAACGTGAATGATCTGCTGGCAAGTCTGCGTAAGGCCAGTCTTGCTCCAAGTATTGCCGGGACG
GGCCATGGCAGTGGAAGTGGTGACACTGGCTCTGCAGGAAATGGGTTGACACCACCAGCTGCCCATGCTATCGTGGCCCC
CAGCGTTCCGCCAGATATTGCCCGTATTCTTCTACCAGGTATGCCAGCAGCTGCCCCAGCGGCTCAAGCTAATGGGGGTG
GCATTGCTGCTGCTGGCACGCAAGCTGCAGGCATTGCCGGCGGGGTTGGTGGTCGTCAGCGTGCTCCAGCAGGCCCAGCA
CCTCCGCCATCTTGGCTCTCACAGTCCCGACATGCTCCACGGCGGATACAGGCAGACACCCAGAAGTACCATACTCCCCG
GGGTATTAGCATGCCTGGAATCTCTACTCCGAGCCACAGAAGTCTCGTCAGTATCGTCGTGCGCAAGATTGCCATCGAGT
GGGCTTTCCAGAGACATTTCAACCAATATTACCTTCCGTACCTTCACGGCGCGTTGAAAGCTGCGGTCGTGTCCTGTCTG
AGTGCCCGTGCAGACGCTGGCCAGGGCGTGACGGTGGCGGACCTGAGGACCCTGTTCCTGCTGCCGCAGCCTTTTACTGC
TCAAAACCGATCCGAAGACGCTGAGGCTGACGGCCGTAATGGCGACTGGGACGACGGTTCTCTGCCGAGCCCGACATTGT
CGAACGAGGATGTCCACTACCTCGATCTCGCGCTGTCGATCGGACGGTCGATACAACTCAAGGAGCTCAGCGACCTTCTA
TTCCCTTTAGGAATGGGCAGATCTTCTGCAGCTGCGAAGAAGAGAGCCAGCTTGGACCTGCAGGAGTCGTGGGATTCCGC
GGGCGAGACATCGCTGCCCCGTTCACTGCTGCCGAACTTGACACATCTTTCTCTTGCCCAAAGCCCCGGAAGCATCAGGT
CTCAGGTGAACTGGCGGCAGCTTCTGGCGTTTGCAGCACACATTCCGACGCTCACGCACCTGAGCCTGGCCTACTGGCCC
GAGCCGACGCTGACGCCCAATGCAAAGTTCGTCACCGTCATTTCGCACGTGGGCGAGAGACGCGTGCAGTACGGCGGGAC
CGGCCCATACAGCCACTCGCTAGACGACGACTGGGCCGAGGCCATCCTCGTGGTCCGAAAGCTGAGCAAGGCGCTGTACG
GCCTTGAGTACCTGGACCTGACGGGCTGTGCATCGTGGATCCCGGCACTGATGCACCGGGCGGACCACGACGCGGTGGAC
TGGGTGGGCGACTGGGGCAAGGTGACAACGCTGGTGCTCTGCTATGGCAGCGCGTGTGGTGACGGGTACGGCGGCGTGGC
CTCGACAGAGCACTTGCCGGGCGAGGTGGCTAGGCAGGTGAATGCGGCCAGCGAGGTACAGATGATTGAGCGTCACATCC
GGAGGCAACGGGCTGGACGGGGCCGTTTTATCACGGTCTTGGGCGACAGACCTGGATGAGTGCTTGCTGGTAGATATGGG
CTGTGGAATGTGAGCTGAGACGGTCACGTGATCGTAGCTCAAGGCGACGCGGATCCGCAGCCTCGTTGACTCGCCCCAGG
TCCTGGCCAGCGATGGATGCTGGAGCCCGCACAGGCTAGGTCTAATACAAAGGCACTCCTTCTCTGCATCTGTAATGTCC
GAGAAAGCTGAAAAGGACGAGACAATGAGGGGGCCAGCAAGCATCGAGCGCTCCTCTTGGAATGCGGCAGCACATTCCAG
TCAGCTCAGCGTAGTCATTGCCCTGCCATCCGGGAACATTCGTTCTATTATTTACGCTGTGACGGGTTTCCTGGTGTGTA
AAGACTGTTTGGCCATTCATAAATACGACCTTGCCCCTTTCTTTGGTGAAGTCGACCTTGACTTCTGCAACTGTTTAGCT
TTACTCTAAACTCTAATCATAATTTGGCTGTTCTGCTTGATTCCCATATCGATATTTTTACCTCATTCTTGAAACATTTT
GACCTCTAGGCTTGACCTTCCTGGATAGGCTTTTCTAAGCAGACTCGCTTGATAACTCTTCCTCTTCTCCTTTCCGACTA
GCTTGCATCTATACTAGATCGTGGCCGGCATACTAACAAACTGTCAACAGAAAGAACTCTTACAGATAAGAAGGCTCCCA
CTGTACTTTGACGTGCTGCTGACAATACACTCCCTGCCTTGCCTTCTTCTTGTCGAACCAGAGAGGGAGGCTCCCTCTTG
CGCGTGGCGATGTGGTTCAATTCTCTCATCCCCGTAGGTTTGTCCATCATTGGATTTATCATCACTACTTTAGGTCTCTT
CGCAGGCAACACGCCCGGCTTCATGGAAGACTACCAGGTCATTATGGTACGTGAGAACCCGCCGTTTTTGGCACTGCCAG
ATGTTGACCGTCTTCTGCTGCAGCTGAACACGTCGGTGCTCGGCCGCAACTACGTCCCACAGCTGTATCTCGCCACGGCC
GGGGCATCACGAGCGCTACGCGAGAAGCGCGACCCGGGACACGGCCACAACAGCAGCGACAGCGACTACGACTACGACGT
CGTCAACGGGACAGCAGCGGACCGACTACGAGCACGGGAGATGACGCTGGCGGCGGCCGAGAACGAGATCGCCGGGCTGA
CGTATGCCGAGGCGGCCAACCGGATGACGGTGCTGCTGGGCATCAGCGAGTTCTATACGCTACACGTGATGAACTCGTGC
GAGGGCAGCTTCTCGCCCAACGTGACAGCGCCCAACAACTGGCGCAACGTGACCAACTGCACGTCGCAGATTGCCATCCC
GCAGCTGAACCTCTCAGGCATCATCGACGGTGAGCTGCAGGCCGGCTTCACCGGCGACAGCGGCCTGCTGGCACTGGGCG
CCTCACGAAGCCTGGCCGGCGCTCTCAACCGCATCCCCACCATCGGCATGGCCATTGCCGTCTTCTATATTGTCGGCGTC
GGTGCCGCCGGTCTCGGCCTGCTGACGTCGGCTATTGCCCTCGTCACGCTCGCCTCGCACCCGCGCGAGACCCTGCTGGC
CGGCCTGGGTACCACGTCGGGCGCAGCCATGGCGCTGCTGATCGCTGCCGTCGTCGCCGTCGTCGCCGCTGGGTCCACCG
TCGACTCCATCAACCGGCTGGGCAAGGATACGATCGGCATGGAAGCCGTCCGGGGCACCGCGTTCTGCAACCTTACCTGG
GCTGCATTTGTCTTCAACGGCCTCGCTGCTGTCTACTGGGCATACCGGCTGCACCAAGATGCACGGGCTGCAGCCGCCGC
AGCCGCCGCCAAAAACAAGGCAGACGCGGCCGCTGAAGCCGAGCCGAAGCCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62