GenePrediction:GLEAN_3911 Details

Name: GLEAN_3911
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1633841..1634609 (+ strand)
Length: 769
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1633841..1634277 (+ strand)
Length: 437
Type: CDS
Source: GLEAN
Position: GCSC_113:1634334..1634478 (+ strand)
Length: 145
Type: CDS
Source: GLEAN
Position: GCSC_113:1634544..1634609 (+ strand)
Length: 66
>GLEAN_3911 class=GenePrediction position=GCSC_113:1633841..1634609 (+ strand)
ATGACGTCGGCTGACATGGACATGGTGGGGCCGGTGGTCCCGCGGACAGGTATTGCGCCGTCGCTGCTGCCGTTCCGCGA
CGACCCGACCGCGTCCAACCCGTTCCTGGACGAGCGGGATCTGGAGCAGGACGACACTGTCATGGAGCTGGGTGAGCGAG
CGGTCAAGCGGGTCTGGGGGGGCTTCATGGACTTTGCGTTGCAGGGCAATATCCTGGAGATCGCCTTTGGCCTGATCATC
GCGGCGTCCTTCACGGCCATTGTCAACTCGTTTGTCAGCGATATCCTGCTGCCGCCGCTGTCGGTCCTCTTGCCGCTTAA
CAAGAATCTGGACGAGAAGTTTGCCGTGCTGCAGCCGGGGCCCAGCTACGCAGCCGAGAACGGCTACAACACATTGCAGA
TTGCCCAGGATGACGGCGCCGTCGTCATGGCCTATGGGTGAGCCTCTCTCCGTCTGTCTGTCTCCTGCTTTGCCATCCCC
GCTCACAGCACAGTGTCTTTCTTAACCGCGCCATCAACTTCTTGGGCGTCGGCATCTCGCTCTACGCCCTTGCCGGCCTG
TACCAGTACTTCTCCCACGATCCCATCATCAAGCACACGGTCAAGTGCAAATACTGCCGCAAGCGCATCAGCGAAAAGGT
GAGACTCCTTCCTCCTCCGTCCTCTTCTCCTCGTTCGTCTCCTTCGCCTGCTGACCAGTCCAGGCGCTCCGCTGTGTCAA
CTGCACCAGCTGGCTCGACGGCCGCGAGGAGCGCCGATCCGGCATGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62