GenePrediction:GLEAN_3913 Details

Name: GLEAN_3913
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1636924..1638499 (+ strand)
Length: 1576
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1636924..1637002 (+ strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_113:1637089..1637156 (+ strand)
Length: 68
Type: CDS
Source: GLEAN
Position: GCSC_113:1637231..1638499 (+ strand)
Length: 1269
>GLEAN_3913 class=GenePrediction position=GCSC_113:1636924..1638499 (+ strand)
ATGCTGTCTACACTCTTGTTCGCTGGAGTGGCCGCGGCCTCACTGACAGTCCCCGATACGCTCGACGTGAGCGATACTAG
TGAGCACACTTCCACGAGCCTGTGGGCGTGGTTCCCTTTTCGTCTGCTGCTTCATCTTGCTGACTTGGTACCTCCCTATG
CTTAGCTTCCATCCTGGATGTCTCCAAGACGCTGGCCTCTGGTGTCATGTCGTACTATAACGGCACGGCCGAGGTGAGTT
GGACGACTGCTTCCAAACTTCCACGACGTATCTGTGCCCGCTGACAAGAGACCGCGCTCTCTCGCAGACGTTCCAGGACC
TGCCAACGCCCTACTACTGGTGGGAAAGTGGAGCGATGTTCGGAGCCATGCTGGACTACTCGCACTACACCAACGACAGC
ACGTACGACGACATGATCGCCACGGCTCTGATGGCGCAGGTGGGTCCAAACTACGACTTCATGCTGCCGAAGCACTACGG
CGACGAGGGCAACGATGATCAGGCATTCTGGGGCTTTGCTGTATTGGCGGCAGCCGAGCGCAACTTTCCGCAACCGGCAG
GACTGACGCCGGCCGGCATGCCGAGCTGGCTGGACTTGGGCGTCAACATCTGGAGCAGCATGGTGGCGCGGTGGAACACG
ACACAGTGCGGCGGCGGGTTCAACTGGCAGATCTTTGCGAGCAACTCCAACGGGCTACACTATCGCAACTCGGTCAGCAA
CGGCGGGGTCTTCCATCTGTCAGCGCGGCTGGCGGCTCTGACAGGCAACCAGACGTACGTCGACTGGGCGGCGCGGATCT
GGGACTGGTCGACAGCCATCGGGCTCGTTGACGAGTACTACAACGTCTGGGACGGCGTGGACGCCAACGACAACTGCTCC
AAGGTGAACATGCTCAGCTTCTCGTACGCAGCCGGCATCTACCTGCAGGGAGCCGCGGCCATGGCCAACCTGACGGGGTC
GCTGACGGCGGGCACGAGCGAGGCCGACCACCAGCTCTGGTCCTCGCGGACGGCCGGCCTGATGGCGGCCACGCAGGCGT
CGTTTTTTAATGGCGGGCCGAGCGGCAACGTCACCGACGTCCTTTGGGAGCATGCGTGCGAGGGCGTCAACACGTGCGAC
ACAGACATGAAGTCGTTCAAGGGCTACCTGTCGCGCTTCATGTCGGCCTCGGCCGCGCTGGTGCCGGTCCTGGCCCCAGC
TGTGCGTACGTACCTGCGCGCATCGGCAGCCGCAGCGGCCAAGGCCTGCTCGGGCACCGGTGACGGCGTGCCCACGCCGG
CTGGTGCTACCTGCGGCCAGAAGTGGTATGTCGGCGGCTTCGATGGAAGTGTTGGCCTGGGCCAGCAGATGAGTGCGCTC
GAGACCGTGCAGGCGCTGCTGGCGCTTCCCGAGGCGCAAGACACGGCTGTCAAGGTGGCTAGCAGGGCAATCTCAGCGTC
TTCACCGGTGACGTCACCGATGAAGCCCGCTTTAGCTGTCAGAGTGGCGATGACATCTGCTGGTGCCCGCGAGATGGGCG
TCCGTTGGTTGGGACTCGGGCTTGTATTCAGCGTCTCGGCCTGGCTGTTGGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62