GenePrediction:GLEAN_3914 Details

Name: GLEAN_3914
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1642195..1644594 (+ strand)
Length: 2400
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1642195..1642504 (+ strand)
Length: 310
Type: CDS
Source: GLEAN
Position: GCSC_113:1643652..1644018 (+ strand)
Length: 367
Type: CDS
Source: GLEAN
Position: GCSC_113:1644111..1644594 (+ strand)
Length: 484
>GLEAN_3914 class=GenePrediction position=GCSC_113:1642195..1644594 (+ strand)
ATGTACTCCACCCAGTACGGCTTCGGCAATGCGGCCGGCCAAGCCTTCAACACGCCTTCCCCTCAGCAGCAGATGCAGCA
GCCTCCACAACAACAACCGCTCCAACAGCAGCAGATGCAGCAGCCTGTTTCCCACATGCCGCCTGGCTCTATGCCTGGAC
AGCAGATAATGTATGGTCCGCCATTTTCTATGGCTGCTGGACCAGGCCCCTATGGCGCCGTTGCTGGCGGCCCGAACATG
ATGGCCAACCCTGGGCCTGCAGGCATAATGCAAAATCCCGCTATGCCCCATATGGCTGCTAACGGGCAAAGTGAGTTCAT
CTAATTATTTTCCAAGACACTGTCTTTGTTTCCGCCGTCTCTACTTTCCCATCCTTATCGCTGCCTTGTTTCTTCTCTTT
CCTGTCCCGTTCTTTTTTCGGGTGTCGTCCACATTCCTTTGCGCTGCCCCTGATCTGTCTTGTGTTATTGTCCGAAAGCG
CATCTTGGCAAGGCGCAATTGGCTATCTTTTCCAACAAACCCACTTCGCGTCGCATTCGAAAGACGTTCAAACCACTACG
CGAACTCAAAAAGTCTGCAATTGATATGCGCAACGCGTCCCTGCACTTCCCCGTTCTTTTATATTGCCCTACACTGTCCT
ACAGGCCCTATGTGGCTGTGACCCATTGGCCCCCCTCGATGGTCAATCCTCGACTTCTCTTTACCGTGCGACAAGGCTGA
CTTTCTTCAATCCACAGTGGCCTACCAGACGCCATACTCCGGCTCACCGTACGGAGCTGGCATCCCAACCAGTGCGGGGC
AACAGATGCCGCCAAACTTCAACATGATGGCTGGCGGACCAATGCAAGGCTTTCCCATGAACCCAAACGCCATCTCTCAG
CAGCAGGCCATGATGCAACAGCAGGCGCAGCAGCAACAACAGCAACGAATGCCTCCACCTCAGCAAGGTCCTGGCGGCAT
GGTATTACCGCCACATCAGCGACAGTTTAATCCCATGCAACAAGGCCCTGGTGGTCCCATGGCCGGAATGCACCTGTCCC
AACAGCAGCAGATCCAGCAGCAGATCCAACTACAGCAGCAGCACCAGCAACAGCAGCATCAGCAGCACCAACTTCAACAG
CATCAGCAGCAACAACATCAGCACCAGCTCCAGCAGCAGCAGCAACAGCAACAGCAACAGCAGCATCAGCAGCAGCTACT
TCAGCAACACCAGCAACAACAACACCAGCAACAACACCAGCAACAACACCAGCAACAACACCAGCAATTTCACCAACAGC
CACCGCCACAACAGCAGCAGCACATCCCACACAACCAGCAGCAGCTCCAACACCTACATCAAACACCACAGCAAATGCAC
CTTATGCAGCAGCAGCCTCAACAGCAGCCATCTCCGTACGGTGGCAGTCCTCAAGTCCTCCAAGGGATGCCTCAGAATGT
AACTCCCAATACACCAGGACAGCACCACCTCAACAACATGCCAGGCACGCCGATCGGGCTATCTACCCCACAGGCCGGCA
ACTTTCCTAACGGGTCAGGTCATGGCGTCGGCGGGCTGATTTCCAACGGTGTCGGAGCCCACGGGCAGGCTGTTGGGATG
GGAGCGCCTCTGAGCCCCGGTACAGAGAGCCGGGAAAAGGAGTTGTTCACTGTCTTGCTGAGCATCAACCAAGAGCTGCT
GTACGAGTCTGTGCAGCTACGAAACACACAGATCGCTCTGAAAAAAGAGCACACAGCAGAGGCTGGTGTAGACGAGCCCT
CAGTCACAGAGTCTTCCGAGCCAGGGTCCGAGGAAGAAAAGCTGGTGCGCGCAGACTACATCCAGTAAGTTTTATCGCTC
TGCATCTGGATTTCTCATATCAGTTTCTCCACCGGCTTTCACACAGCCAAATTTCAATCACCGCTAACAGAGATAGGTGC
ATGAAACGGATCCAGTCAAACTTGTCCTATCTGGCGAGCCTGGCCGACCGCAAAGTGACGGCGAACGCTGCAAAGGGCCC
CGGCTTCCTGATGGCACCCGCTCTGAGCCTGGGCTTCAGGCTGCGGCCGCAGCCGTCCTCGGCACCGGATGCCATCGGCA
TGACCGACGTGGATATCAACAGCGACCGCGAGGACCGGCTGCGCTACATCAAGGAGCTGTACGCCAAGCTGCAAAGCTTC
TACCCGGGTGTAGATTACACTAAGGAACCGGCGTTTGGCCCCCAGTCGAGTGGCGCACACGGAGCCCCCGGAGGGGCTGG
AGTACCAGGACCGAACCCTGCCGCGATGGCCGCCTTCAACAACCGCGCTATGTCTCAAGGCGTACATCAGGCCAGCCCTG
TGTCACAACCTCATCGGACACCACAGATGGGTATGATGGCCGGCCCACCCGGTCCTCCACAAGGCATCCCCATGGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62