GenePrediction:GLEAN_3915 Details

Name: GLEAN_3915
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1646127..1649710 (+ strand)
Length: 3584
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1646127..1646663 (+ strand)
Length: 537
Type: CDS
Source: GLEAN
Position: GCSC_113:1646744..1647357 (+ strand)
Length: 614
Type: CDS
Source: GLEAN
Position: GCSC_113:1647463..1649710 (+ strand)
Length: 2248
>GLEAN_3915 class=GenePrediction position=GCSC_113:1646127..1649710 (+ strand)
ATGGAGTCCGACGGGAACGGCAAGCCCCAGCGTATATCAGTAACAGAGCATGAGCCGACCTCGCCTACGGTGGCAGAAAT
GCCGGCTTTGGAGCCAGAGTCTCTTCCCGAAGACACTTCTGTGCTAGATGTCTCAGACGCGCAAGATGGCACCCCAACAG
AGCTAGATGGCGCAGATGAGTCTCTTATTTCCGGAGAATCTCAGGTTGCAGTAGATGCAGACAGCGACCCTGATACCGTT
CTCGTGGACAATACTGCAGCCACAGCCGCCGATGAAGAGGACATGAGACGTCTAGACGAACACGATTCTCTCGTCACTGT
CCGCCTGTCCGAGCCGCCTGTGTTGACAATCGACACAAGTGCCGCCGAGCAGAGCGACGATGAGCCGAGCACTCCGGCCG
CCACACCGAGCATCAGGACGGCAATGCCCACGTTGTGCGAAGCTGACGAGTCTGATGACAGCGTCGATCCCGATGTTAAC
TGGGAGCAGCTGCAGCGGACTGAAGACGAGGAGTGCAGTGGTAAAGGCACCGAGAATGTATGTGCTTTCTTTTTGGGGAG
GGGGGTTCTCGCCTTTTCGTTTATCCGTGCCAAATGCTGACCGCTGACACCGCATAGACTGCAATGCTGCTTGCCCGCCT
CGAGCAAGAAAACGCAAAGCTTGCAACGAACCCGAAAAGCGTCAAGGTGTACGGGCCCGAGCCACAGCAGCAGCAGACAC
CTCGTCGTCCCCGGCCTCCCTCCATGGCTCAGCTCCGTGATATGATCAACGGGCCGACGCCGCCTGCCCTCCGGTACTCC
ATGCTGCCGCCGCCTCCCCTGACAGACCTAGAGTTCTATGCGGCCCTAGTCCAGGACTACCACCAGACCGCCGCCCGGCT
GCCCACGCTTCTAGCCAACAAGATCCGCAAGGGCATTCCGCCCCCGCTGCGTGGTGTCGTGTGGCAGGGTATGACAGATG
CTCGTGACGAAGAGCTTGGCAGCCGGTTTGATCGCTTTTGCGTCGCCACGAGCCCCTACGAGGGCCTCATCGGCAAGGAC
CTTGGGCGCAGCTTTCCTGGCGTCGAGATGTTCCGTGACCCAGACGGCGACGGCCAGCGCATGCTGGGACGTGTGCTTAA
GAGCTACAGCCTGCACGACCGACGCATCGGGTACTGCCAGGGCCTGGCATTCCTTGTCGGGCCGCTGCTCATGCACATGC
CCGACAAGGAAGCGTTTTGCGTTCTCGTAAAGTGAGTGCTTCATCTAGCTCGACTTTCCGTGGCCGCCATTTGAAAGAAG
TATGGCGCTGTTTTTTGGCGTCTTCCCAATTTCTTACACTTAATTTTCTGCTACAGACTGATGGAAAATTACGATCTTCG
GAGCTCCTACACGCCCGACCTCGCCGGCCTACACGTCCGCATCTACCAATTTCGAGAGCTGTTGCGCGCAGTTCTGCCAG
AATTGTCGGCCCATCTGGACGAGTTGCAGGTGGACCCAGCCGGTTACGTTTCACAGTGGTTCTTATCTTTTTTTGCTGTG
ACATGCCCCCTGCCCATGCTGTTTCGCATGTTCGACGTGGTCTTTGCTGAGGGCGCGGCGGAGACGATTATGCGTGTAGC
GCTATCCATCATGCAGAAGAACGAGGAGCGCCTGCTGGCCTGTGCCGAGCTTGAGGATGCGATCCAGCTCTTGCTCTCGC
GCGGTCTCTGGGATTGCTACCACTACAACGCCGACGAATTCGTGCAGCATTTTCTAGGCTTGTCTAGCGTTGTCACCCGA
GACCGGTTGGCTTTGCTTGAACAGGCCTACCGCAAAGCACAGGTCACCAATACTAATCAAACCGGCAACGCCAATGTGGA
TCGCACGTCTGCCATTGCGACTGCAGCCTCTCGTTTCCTTGGTCGCCTCTGGGTGTCATCCTCGTCCTCATTTTCTCTAT
CTTCCCCCCCGACCGCTACATCTGCCACCTTCCCTTCATCCTTCCGTTCCTCAGGTGCATCGTCGCCCAACACATCCGAC
CCGTCCAGTTCGGCGTCTCCCTCCGCCTCCAACGGCCTCAGCTTAAGTGCGGCGCCGCTGCGCCCTCTTAGCATGTTGCG
GAGGAGTACCTCCAAGCAAAGCCTTGCCTCCACTGTTAATTCTATGGAGGCAGCCTCCACGTCTGCCGCGACATCGTCTA
CCTCCTCCACCGCCTCATCGTCATCCTCTGTCCTAAGCACCGCCTCCACCGAGGCGACGTCGATGTCGCGCGACTCGGCT
AACTCGACGAAAGCGAACACGTCAAATGGTGCGAGAATTGTCAGCAGCATCCTCAGCAAACCACCCGACAATGAGCGGTA
TCTCAACAGCCAGATTGAGGACCTCCTCACTGCTCTCAGCGACCTGCAGCGCCAGCATGCCGTGCTGGTGGACCGGCTGC
AGAACGACCGAGAGGATCGCGATGAAGACCGGAAGGCGGTGCGGGCGCTACTGCATACTCTGCGCGAGAAAACAACAACC
CAGAGCCCTCCACCCGGCAGCAGCGAAGAGGAAGAAGGCGATATATCCGATGAGCAGGAGGGCACAGAAAAGCCGACTGC
GTCAACACGTCGCACAGCACTGCCTACTGACTTCAATTGCATCATATCATGTGAAGAGCTTACTGCTCTGCTGGAGCCAG
TGGATGCCCGATTTCCCTCGGATTCTGAGGACTGCCAGGCGCCAGCCCAGCAGACGAAAGCGCAGTTGCGCGATGAGCTG
GCTCGCGCAAAGGAGCAGCTCGCCCACGAGGTCGAAAAGGGCCGGGAGCACAGCCGCCGAGAGTATGACCTGGAACAAGA
AGTGTCCACGGCGAAAGAGCAGCTGCGAGACAGTCACGCGCACGTACGAAGCCTTCACCAAGACAAGCAGCGGCTAGAAC
GGTTGATACACGACATGCGAACACGCGCTGCTTCCACATCTTCAGCAGGTGCTGGAGCCGGAGCCACCCAGAATGAAAAA
GGCGCCGGCGATAGAATCAGTGGGGGTGCTGATGCTGCGGGCGAGTGGTTCGGGCGAGCCACAGGACCAACCACCTTAAG
CGGTAGGATTTCCAGTAGCGGTCTGCGTGAGTTCAAGCTCAGCCGCAGCAAGTCCACGCCATCGCAGGTATCGGCGTCAT
ACGTCCCATCACTCCCCGTCGGCAACGGGGGTGCCCAGCGGGCTTCGTCGCTCACGGTTCGCGGCGAGTCCGTGTATGGA
TCGTCGAATATCAGGCCAAACAGTGGCAGCATAGACCAGCAGTCGGACGCCCTCGTCTTGGAGCTTGTGCAAGCCAAGAC
GGCAGAGGCAGTTGCCCGGCAAGAAGTCGAGGAGAGCAGACAGAAGTTCGACAGCCTTCGTAAGGCCCTGGGGCTTTCGC
CAGCCGACATGACGGCCATGCTGCAGCACGCGGGCAATCGGGGCTCATCAATTATGGCCTCTACTGCTACCAACACGGCC
ACGGCGGCAGCCATGAACATGCTCGGTCGGCACGCAACCGCGCCGGTCGAGAGCGGCAACAAAAGCCCGACAACAGCGAC
GGCACCGACTGCGACCGCGGCACCGTCAGGATATGGTGGCTTCTTTGGCTGGAGACGCCAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62