GenePrediction:GLEAN_3916 Details

Name: GLEAN_3916
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1651138..1652434 (+ strand)
Length: 1297
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1651138..1651194 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_113:1651463..1651535 (+ strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_113:1651600..1651901 (+ strand)
Length: 302
Type: CDS
Source: GLEAN
Position: GCSC_113:1651958..1652434 (+ strand)
Length: 477
>GLEAN_3916 class=GenePrediction position=GCSC_113:1651138..1652434 (+ strand)
ATGGCCAGCACTGCCAGCCCTCCCGCCGCCAATGGCAGCTCTGCTAAGAGTAGTGAGGTGTGTTTGCATGTCTCGTTGCC
ATGTTCTGGTTGCAGTAGCTTTGTGTCCTGCTGGCACGACGTATCAACATACGAAGACACTGCTGACAACTCCGTCCTTA
ATCACAGTTCATCCCGGAATCGTTCCATATCCTTACTTGCTATATGCCATCTCCACAACACTGTTGCCCTCGTGTTCCAG
TTGGACCTGACCCGGGCGCTGCGACGAGCACAATAGCAGACCGATACTCTGCAATAGTTACGATGCTGACCTATGCTTAG
ACCAGTATTCGGAGCCTTCGGCCCCGCCGACCTATTTCCACTCATTTTTCTCCAACCTGCTATCGTGGGACAACCCTCGT
AAGTTTCCGGCAACTGCCGTGAACAGAGACAGGAAGTATGAGGGACTGACCGGTCACAACAGGGTCGTCTGCTATCGCCT
ACGCCTCGATTGTGACGTTTATCGTCGCAGGCCGGTATCTCGATGTGGTCCGGTGGGCTTTCAAGTTGACCTGGATTGTG
CTGGGTGTGGCCGTGGCTGCCGAGGTTGCCGGTAAGGCCGTGCTCAACAAAGGTCTGGCCAGCCAGCTCCGGCCTCGCCA
GTACTACACCATCCCGCGCGAGACCTTTGAGGCTCTGCTCGGTGACATGCACGATCTGCTCAACTTCTTCGTCATCGAGG
CTCAGCGCATTGCTTTCGCCGAGAATGTTTACGCTACTGCTGCCGTACGTTTGTCCCACTGATATTCAGCCGAAAGAACT
GCTTGCTAACGTATCGCCAGGCGTTTGTCGGTGCCCTGATTGCGTACATTCTCATCAAGTTCGTGCCGTACTGGGGTCTT
GCTCTGATCTTCAACACGGTGGTCTTCTTCGCCCCCCTTGTCTACAAGACCAACAAGGAGCTCATCGACGAGCAGCTGAA
GCAGGCTTCTAACGTGATCAACACCCAGACCAGCCAGCTTCGCGAAACCGCCCACAAGCACACTGCCCATGCCGCTGATC
TCACCAAGCAGTACCTAGGTGACTACACTACCAAGGCTCAGCAGCTGCTGCGCGGCCGCCATGCCACGTCCGCTGCGACT
ACCCCAATCGCCCCTTCTTTCCCTACAGCTCCCAGCACTGCCCCTTCGCAAAAGGTCAGCGAGGCCGACTTCCCCACCGC
TCCCAAGGCGGCTATCCCTATCCAGAAGCCGGTGGCCGACGAAGACTCGGAGGAAGAGTCGTCTGAGGAGGAGGAGGAGC
CGCTCATCTCCGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62