GenePrediction:GLEAN_3919 Details

Name: GLEAN_3919
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1677757..1680718 (+ strand)
Length: 2962
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1677757..1678249 (+ strand)
Length: 493
Type: CDS
Source: GLEAN
Position: GCSC_113:1678324..1679747 (+ strand)
Length: 1424
Type: CDS
Source: GLEAN
Position: GCSC_113:1679800..1680361 (+ strand)
Length: 562
Type: CDS
Source: GLEAN
Position: GCSC_113:1680531..1680718 (+ strand)
Length: 188
>GLEAN_3919 class=GenePrediction position=GCSC_113:1677757..1680718 (+ strand)
ATGGCAACCAACGTCTCCCCTGCCAACTCGGCATTGGGGGACTTTGACAGTCCCCCATCCGACGATGAGTCCTGGGCTTT
TATGAGCACGCCTATCGCTGGCTCTCTTTCGGACTCGTCTATTGTTTTCTTACCGAGCCCGGCCAGCCACAGTCTGGCGT
CGTATGGTGTTGTTGCCCATCACGGCCATAGTTACCGGGGGCCAAGCCCAAGTCTCAGCAACTTGAGCATGAGCCCTGGT
CCCTTTCAGATGGTGTTGAATTCATCGCCACCCCCTCTGACATCTGCGCCATCACCGGTCCTCCTCTCGGCTCATAGCCA
ACGACTACCAACCTCATACTCAGTACAGTACACTGACTTCATGCCTGCTTCGATGAACGCTACCGGCCTTTTAACCGATA
ATGGGCTCCCCATGGCGCCATCGGACATCTCAACTAATGCCAGCGGATTTATGCCTTCACCAAGTACATACCTCCTAGAC
CAGCAATATACATGTAAGCTCATTCCGTGTGATGTCTTTCATGGCTTCCATCCTCTCGTACCATAATTGACTTGTTTTCC
TACGTAGCACTAAGACCGGATCCCTATTCTGAAGCCCTACAGGCCTCTGGACTGGCAAATGACTTTTCAAGACTTGAACG
CGAGAATAATCAGCATCAAGCCCGGCTAGGAGCCCAGGGTCAGCAGCAGGTAGCCAGGCTCGACATCCCCTTCCAAATGC
AGTCCCCTGCCAATGCCAGCCCCTGGAACCCGATGGATGTTTCCGAGCAGCACGATTCCCCGATGTTCACGATGGACGAT
TATATCTCGCCATCCCCGCAAGGCACATTCTCCTCTACCAGTCTCGCTTCTGCTCAAGAGGCCGGTATGCGGTCTGCGGC
CAACATCATGCTGGAATCCATCACTGGTGCATACGAGCAACAACAGTCTCAAAACCAGCAAATCTACCAGTTTCAGCAGT
TCCAAATACAGCAGTTTCTCCAACAACAACGGTCGCCTATGCGGCAGCACCAGCAACAGAAAGTGCAATCTCAGCAGGCA
ACTACAGCCGCTCATGCTTCAACTGCTACCAAGGCTACGCCATTGGCTGGATCCTTGACCAAATCAGTCTCCTCAAAGCT
TGCTATTGGTAACTTGGACAAAGTGAAGGGTACAGGCTCCCGGGTTGAGAAGAGGAAGACCGGGAATAACTCCTCTGCAA
ATGAGAAGTTCCAACCCACTACAAACGCTGGCACTGGCAACAGTGTCAGTAACGAAGACAGATTTATCATTGTCACTCCC
ACGACAATCAGTTCACATGCTAGCAGCGGCAGCAAACAAAACCTCTTCGACCACCTCGAGGCTTTCAACACCACCCAGAA
GGGCCGTAAAGGTCCTTTGGCTGACGAAGTCAAAGAAGGAGCGCTGCAAGTCCGCCGCTTGGGAGCATGCTTCTGTTGCC
ACGCCAGGAAAGTCCGCTGTGATGCAAACCGTCCGTGCAAGAACTGCACAAGGCTTGCAACGTCTGTGCCTCAGGTTGTG
TGCTGGCGCTTTGATGATTTTCTTGTGGAGCTCTTCCCGGCCATAATTCGCTCCCACTTCCGCAAGGACGAGATGGCGGC
GTACATGTCTACCCACATCGCTGATTTCACTCAGCCGTGCACCGTTTTACTGTCCTGTGGTTTAGGCTTCAAGAGCACAT
TGGAGATCCGTGGCGCCAGATTCTTCACTGCCAAGTCGCGTGAAATACTACATCATGAGCGGTTGACCCTGTCCGGCAAC
CGGAGTCACCTGAAGTCTTTTATGGCGGCGCCTATTGCTCTGGACCTATCTGAAACCTCTTGCACCAGCGCTTCGTCGCA
GCAGGATAGGATTAAGAGGACTTTGCGTGTGTACATCGAAAACCTAATCAAGGAAGACACCTACGTCGAACAGCTCACGG
CCAATCTTCGGCAGACAGGCCTGCCCAAGAAGATCCTGACGATTGTCCGAAAGTATTACTTTCAAACAAATGTAAGTGCT
AACCGCATTGCTCCTTGACATTCAATACTAACAGATTATTCAGTCTCCTATCGTCAAACAAGCTCTCGCCATATATACGA
TGCACTACGTCATGTCGCATCATATCAGCCTCACAAAAGAGACCATTCTCGATCTCGCGCCCTCTGGCATGGTGCCACAG
AACGACATATTTGTGACCCCGCGCATGCTAAACCGGCAGGTCAAGGCCGTTCTCGATGAACTGATGCAGGAAGAGGTCGA
TAAGCTGTTCAAGATGTTTACGCGGGACCTAAAGCCAAAGTCGCGCAATTCGTGGGCTCCGTGCTTGGCCGCGTTTCTGG
TATTCTGTCTCTTCATGGAAGCTGTGGGTCTTGCTCTAGACCATTTTGCTCTTGCTCATAATGAATCCGACATACAAAAT
GAGCGCGCCATGCAACCCAACTTTGCCCGTTCCGAGGCCGTCAAGCTTGGTCGGGCTATCGAAAACCTGCCCTTCCGCCA
GTTCGCTCACCAGTTCCATTACATATACCAAACAGGGGCAACCGCATCGGGCAGCTCCACGACTTCTACCACCACATCTA
CATCAGGCTCTTCACCATCGTCGTCTAGTAGCCAGGCTTCTTCTTGTTCGTCCACGGCGTCATCTGCAGTGAAATTTGCT
TTCAACCCTCTTGATGACGATAGACTTCTCGTTTCAGGCGATCTGGATGACTCGGCAGTGGAAATGGTTTCTAGCTTGCG
TGAGTTGTTGTCAGGCGATTCTTGTGAGCCCCAAACCCATCTGCCCCTTTACAGTCAATGGGTCCATCACTCTACTCACG
CGCGCAGGGTATGAACTAGATTTTTTGGGCGGAGACTACAATTTGGACACCATAGAGCCACACCCGTACCCGCGGGATGT
GACCTTTGACTATACCGGGCGATTGTGCTCAACATTCTTGCTATCTTTCACAAGGCCTAACAAGATACTTCAATCATCTT
GA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62