GenePrediction:GLEAN_391 Details

Name: GLEAN_391
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1487018..1488015 (+ strand)
Length: 998
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1487018..1487129 (+ strand)
Length: 112
Type: CDS
Source: GLEAN
Position: GCSC_167:1487192..1488015 (+ strand)
Length: 824
>GLEAN_391 class=GenePrediction position=GCSC_167:1487018..1488015 (+ strand)
ATGGCCAATACAGCTCAGACCAAGCATGACAAGGACGCTGTCGCAGAGACAACCTCATCTGATTTAGCAGAGGCAACGGC
AACGAAGAAGCGCAGGGACACAAACAATGCATGTGAGTCGGGCTCGATGGCGGTTGTCAAGATACAGGACTGACATTGTG
GGCACTGACCCCAGTTTCTGAACTGATGAGGCCCAAGCGACCGAAGCTGGACACCCCTGCCAGTACTACCGGCCGTCACC
ACAATCGCTTCTTCGCTGGCAGTGACGGTCTCGGCGTCTACATTAGCGATCCGGCCGCGCACCTGATGGACGGCCCGGCT
GCTACTGCAGACGGCGGATCAGCCAGCGGCAGCCGCGGTAGCCGCGTCATCTTCTTCACAGCCGACTTTGTGGCCATTCA
CGACTTGTACCCCAAGGCCACGGTACACTGTCTGCTGCTGCCGCGCGACCGACGCTTCAACCGACAGCACCCGCTGGAGG
TTCTCAGCCGCCAGAGCGACGAGGCGGCCAGCCGGTTTCTTGCCGGCCTCCGGGCCGCGGCCGAGCAGCTGCGGACGATT
GTGGCTGCTGAGCTGCGGCGACAGCTGGGAGCCGGGAGCGCACAGGACGCAGCGCGGGAGGCATTTATGAGAGGAGAGGG
CATGGACGAGGACGGCGAGGGAGAAGTCGGGGGAGATCCGCCACCTGGCCGAGACTGGGCGGCCGAGGTCCTCGTCGGCG
TGCACGCCCATCCCAGCATGAGCCACCTGCACGTACATGTGCTATCGCGAGATATGCACAGCGACCGGTTGCGCAACAGC
TCGCACTACAACTCGTTCACAACGCCTTTTTTCGTACCGCTGGACGCCTTCCCGCTCGCGGCGTCGGACCCTCGACACAG
TTCTGACTCTCTGCACCAGAGCATGGCGTGCTGGCGGTGCGGACGGCAGTTTGGCAACCGGTTCGCGGACCTCAAGCGGC
ACCTGGAACAGGAGTTCCAGGCATGGAAGCGCGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62