GenePrediction:GLEAN_3920 Details

Name: GLEAN_3920
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1689973..1691659 (+ strand)
Length: 1687
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1689973..1690922 (+ strand)
Length: 950
Type: CDS
Source: GLEAN
Position: GCSC_113:1690972..1691659 (+ strand)
Length: 688
>GLEAN_3920 class=GenePrediction position=GCSC_113:1689973..1691659 (+ strand)
ATGAACGGTGGCTCATGGGATGCCACCATTGAAGGATCACAGAACTTCGCGAGCTACTCCGACCAAGGAGACATGCCCCA
GGATTCTGAGGAAAACACATACCAGGCGAACAGCATGGAAGAGTACCAGAGCAAATGGAACCTGCCTCCTGCCATGCACC
GGACGGTGTCGCGGAGCTCTGCTGGGAGCTACAAGAACCGGACCGTTCGTGCTCCGGCACGGAGAACTCGCCCTGGCATC
CCGACAGAGCTCTCGCAGGGAGCGCCGACGTCTGCTTTTGATGCTTCCGTCTCTGCTTCCATGTCTGCTGCCGGCTACGG
TATGACCGATGCGTTCTCGGCCAACAGCACGATGGCGACTGCCATGACTTCGGTGCCGTCTGTCGGCCAGAACTACTTCC
CGGATGCGTCGATGGGACCGAGCAACCAGATGCTGCAGCAGCAGTACTTTCCATCGCTTTACCAACCCAGCCTTGAGTCG
ACATACAGCCCGGACGGCCTCGCCTACGTCGGTGATCTCGGAACGGGTCTGGACCAGCCGGTGCAGCAGCACGTGGACCC
GGCCTGCACGCAGATGCACTTTGAGCCCAGCGTGCTCAGCTCGCCGCTCACAATCGACACGCGCAGCTCGCGGCGGTCTT
CTCTCGACATGGCGCCCGAGGACATGTGGTCGTACCGGCCGGAGTCGTCGTCGCCTGCAGAGAGCCACGACTCGACGATG
TCGTCTTTTGGCCCGCTGCCCGGAGCGGAGGAGCCCATGCACAGCGCCATGGCCAGCGACTTTAGCGGATCTGCCACGAT
GCGGCAGCGCTCCAGCAGCGAGAGCGACACGGTCCGGGACCACCCCCTGTACAAGGAGGCGATTGCCGACGATGATGGGC
TGTACCACTGTCCGTGGGAGAGCGAGTCGAACTGCAACCACAAGCCGGAGAAGCTCAAGTGCAACTACGAGTCAGTGTCT
TGTTTTCTTTCTTTCTTTCTTTTTCTAACCTGATAACAGCAAATTTGTCGACTCGCACCTGAAGCCGTACCGCTGCAAGA
ACCAGATGTGCGAGAACACGCGGTTCTCGTCGACGGCCTGTCTTCTGCGCCACGAGCGTGAGGCCCACGCGATGCACGGC
CACGGCGACAAGCCATACCGCTGCACGTACGATGGATGCGAGCGCTCGACCATGGGCAACGGGTTCCCGCGGCAGTGGAA
CCTCAAGGACCATATGCGGCGGGTGCACCACGACGAGAGCCTGCAGATGGCAGCGGCTGCCACGCTGCCATCGCCGCCGC
GGACGTCGAGCAGCAGCCACTCGCTGAGCAAGAACCGGAAGCGCAAGAAGGACAGCCTGTCAGGTCACGTGACAGCGGGC
AGCCTGCCATCGCGCAAGGCATCGTCTCGAGGCAAGGGCCAGCACAACGCGGCAGCCGAGGCCGACAGCAGCCGGTCGCA
GGCCCAGATGCAGGCGGCGGCGGCCAAGGCGCAGCTGGACCAGTCGTTCAAGATGTGGAGCGAGCACACGGCGACGCTGC
GCGACATTGTCGGCAACTTCAGCCAGCCGTATGCGCTGCAGACATTCCAGCAGCTGCAGGACGCCCGGACACACCTGTCC
TTCCTCGAGCAGATCCACACGGCCATGGCACAGTCGCAGAGCGCTGCGGATCTCGGCATCTACGGCCACTCGCAGCAGCT
GGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62