GenePrediction:GLEAN_3921 Details

Name: GLEAN_3921
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1700431..1703990 (+ strand)
Length: 3560
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1700431..1700582 (+ strand)
Length: 152
Type: CDS
Source: GLEAN
Position: GCSC_113:1700658..1700770 (+ strand)
Length: 113
Type: CDS
Source: GLEAN
Position: GCSC_113:1700842..1701135 (+ strand)
Length: 294
Type: CDS
Source: GLEAN
Position: GCSC_113:1701196..1703990 (+ strand)
Length: 2795
>GLEAN_3921 class=GenePrediction position=GCSC_113:1700431..1703990 (+ strand)
ATGGCTTCGGGGCGATTCAGCGCCCTCGCTGTCGGGGTCTTCGCTGCTTCCATGGCAGGCGTCGTGGCGGCCAGCTCCAA
CTTCACGTCCCTCGATGCGATGCAAGCACAAATAACCCTTATGAGCGGCTTCCCTAAAGATTGCCCGCCTTGGTATGTCT
AGCCCGATCGATGGAATTCGGATTCCATGTTTGTCCTCCATTCCTGCTAATCTCAGCTTCTGTCCAGCTTCAACTGTCTC
ACGCCCTCTTCCACCTGTGGTCAATATGCCGAGTGCAACAGCTATGATGGAACATGTGTCTGCCCTCCAGGATGGGCTGG
TACGGACTGCCTGAAGCCACGTCAGTACTCTCCTACCACCGGTCTACCGCTACAACTGCCAGTTCGTCCAACTAACCCCT
GCTGCTTATAGTATGCGGCTCCCTGGCTGGCGGATACGATCGTCCTATGCGTGATGAAGGCTCTACCTGTGAATGCGACG
AGGGCTGGACTGGCATCAACTGCAACGTATGCACCGAAGATCTAGCATGCAACGCCCTGATGGAGACAAAGGAAGGCGGC
GTATGCTACCAGAAGGGCGATGTCATCAAGAACAACTACCAGATGTGCGACGTCACCAACAGGCATATCCTGGGGATGCT
GGACGGCAAGATACCACAAGTCACCTTCACCTGCGACCGCAACAGTTCTGAGTGTGATTTTCAGTGTACGTCATTCCCGC
TCCTGTGATTTTCTGCCATACATATTGCATTCTGACACAACACAGTCTGGGTCGATCAGGCCGAGTCGTTCTTCTGCCAC
CTGACCGACTGCGATTCGGATGCTCAATTTGACGACTCTTCCAACAACACCCAGTATCGTTGCAAGACTATCGACTGCAG
CTGTGTACAGGATCGCATGCTCTGTGGCAAGGATGGCTCCGTCGATCTCACCGACTACTTGAAGGAGGAGATCAAGGGTC
CGGCTTCCTTTGAGTGCGCCCAGAAAGCCCGGGGCTCCAACGACTGCTCTTTCGAAGAACCGCACATGAATGAGCTCATC
AGTAGCATCTTTGGGGATCCCAACATCTATCTCACCTGCCGCTCGGGCGAGTGTCTCTACAACACTGAAGTTCCCGGCTA
CAAGAAGCCCGTCCCGAAGATCAACACGCCTCTTATCGCTGCCGTCATTGCTGCCTCTTCGCTCTTCCTCGTTGCCGCTA
TTCTGCTGACCTGGTACATGTCTCATCGCCAGTTCAAGTACGGGCCTATCAACCTCGACGACTCGGACGATGAGTCCATC
AAGCTCATGACCGACCACAGACCTGCATCTCTGTACTTTGAGCATGTTTCCTATGTCCTCAACGGAAAGCTCATTCTGGA
TGATATCAGCGGTCTGGCTCGTCCTGGCGAAGTAATGGCCATCATGGGCGCTTCGGGTGCCGGCAAAACCACGTTTCTGG
ACATTCTTGCTCGCAAGAACAAACGCGGCGATGTTTCGGGCGACTTCTACGTCAATGGCGAGAAGGTCGACGACAGCGAC
TTCAAGCAGGTCGTCGGCTTTGTCGACCAGGAAGACACCATGCTGCCAACACTGACAGTCCACGAAACCATTCTCAACAG
CGCCCTTCTGCGTCTCCCGCGCGACATGGGACGTTCAGCCAAGGAACAGCGAGTTTTTGAGGTAGAGAAGCAGCTGGGCA
TCTACCACATCCGAGACTCCCTCATCGGCTCCGAGGAGGGCCGCGGCCGTGGCATCTCGGGTGGTGAGAAGCGCCGTGTA
GGCATTGCCTGCGAGCTCGTTACGAGCCCGTCTATCCTCTTCTTGGACGAACCTACCAGCGGTCTCGACGCCTACAACGC
CTACAACGTTATCGAGTGTCTGGTGACCCTGGCCAAGAACTACAAGCGCACCGTCATTTTTACCATCCACCAGCCGCGTT
CCAACATTACCGCTCTGTTCGACCGTCTCATGCTCCTTGCCCAGGGTCGTACTGTGTACTCCGGACCCTTCACGCAGTGC
CAGGACTACTTTGATGATATCGGCTACTCGTGTCCTCCAGGCTTCAACATCTCCGACTATCTCGTCGATCTCACGATGCA
CGCAATCAACCCCGAGCCATTCAGCGACGACGATGTTGTAGGCGGTCCGATTGTGACGGTTACAGTCTCTGACACAGCTA
CCGAGCGCCCGAGCAGCACCCGTGCCGTCAAGTCCATTGCCAGTGGTTCGGCTATAAGCCTAGGCGCCGATGAGAGCGTG
AACGCAAGCCTGGCAAACGTCGAGGCCACATCGTCGGCGGTTCGCCACAAGGGCAAGCATCGGGATTCCGTCCGTCTCCG
CCAGGAGCGAGAGCTTTTTACCCGCCGCAAGAACACGGTTGATACGGTTGCCTCATCTGAGGCAGGCGACGACGCAGTAG
ACGGCTTCAAACTCCGCCTTCAGCCACCCCATATCGTCCCGCCTCAGATCGTGGATGACCCTGACGACCCGCTGCCGGGA
TCTTTTGGTGGCAGCGACCTCGATGGGCTTGTGAAGTCTTTTGCTCAGTCCGACATTGCCAGCAGCACCCACGATGAAAT
GCACCTCGCCATCGCCGATGCCCTGGCCGCCAACGGCCTCAACGCGGACGTTGCTGAAAATGGCAATGGCAATGGCACTG
GCTCTTCTTCTCCACAAGCAAACGGCAATTCTTCCGGCAGGACAAAGACACACCTGAGCGTTGTCGGCAGAGGCTACGCG
AGAGTGGGCTTGCTCCGCCAGTTTGTCATTCTGTCGCAGAGGACGTGGAAGAACCTGTACCGCAACCCGATGCTGATGTT
GACACACTACGCCATCTCCATTCTGCTCGGCGTGCTGTCTGGCTTCCTGTTCTACGGTCTGACAGTCGACATTCCCGGGT
TCCAGAACCGACTGGGTCTATTCTTCTTTGTGCTGGCTCTGTTCGGTTTCAGCACCCTGACAAGTCTGAGCACCTTCTCC
GGCGAGCGGCTGTTGTTTGTGCGGGAGCGGGCCAACGGCTATTACTCGCCCATCACGTACTTTGCGTCCAAGGTGCTCTT
CGACATCATTCCGCTGCGCATTCTGCCTCCAATCTTGATGGGCTCCATCATCTACCCCATGACAGGTCTCGTGCCAGATG
TCCAGCACTTTTTCGTTTTCATCCTGGTGCTTGTGCTCTTCAACCTCGCTGCGTCCGGAATCTGCCTTTTCATCGGCATC
GTGTGCAAGGACAGTGGCGTTGCCAACCTGATCGGCAGTCTGGTGATGCTGTTCAGTCTGCTGTTTGCCGGTCTTCTGCT
GAACCACGACAAGATCCCGGCGTCCGCTGTGTGGCTGCAATACCTGTCCATTTTCCACTACGCTTTTGAGTCGCTTATCG
TCAACGAGGTGCGCTTTCTGGTCTTGGTCGACCGCAAATATGGCTTGGATATCACTGTGCCCGGCGCCGCGATTCTCAGC
TCCTTTGGCTTTAATAACTCGTCACTCTGGAAAGACATCACCAGCCTGGGCGTCTTCGCCGTGGTCTTCGTCATCCTGGC
TTACGGTGCTATGCACATTTTACTGGTGGAGAAGCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62