GenePrediction:GLEAN_3922 Details

Name: GLEAN_3922
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1705815..1708414 (+ strand)
Length: 2600
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1705815..1705914 (+ strand)
Length: 100
Type: CDS
Source: GLEAN
Position: GCSC_113:1705986..1706710 (+ strand)
Length: 725
Type: CDS
Source: GLEAN
Position: GCSC_113:1706769..1706795 (+ strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_113:1706851..1706877 (+ strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_113:1707266..1707529 (+ strand)
Length: 264
Type: CDS
Source: GLEAN
Position: GCSC_113:1707590..1707692 (+ strand)
Length: 103
Type: CDS
Source: GLEAN
Position: GCSC_113:1707759..1708181 (+ strand)
Length: 423
Type: CDS
Source: GLEAN
Position: GCSC_113:1708317..1708414 (+ strand)
Length: 98
>GLEAN_3922 class=GenePrediction position=GCSC_113:1705815..1708414 (+ strand)
ATGGGAACACAGAAGAAAGAAGCCACTCGGCGGGTCCGTGAGGGCAAGACGACCGATGGCAACATCAGAGTGAAGGGCGA
AAACTTTTACCGCTCAGCGAGTAAGCTTTCCCGTCCCACCATTTGCGGTGTTGAGATGAGGACGAGCAAGCCAAGTACTG
ATGCGGTCCAGAAAGGGTAAAGCAGCTCAATGTCTACAAGGAGGGTCGCGCCCAGCGCGATGCCGACGGCAACATCACCA
AGGCTGCCGTCTTCCAGAGCCGGGATGTGCCGACAGCTGTGATTGAGCCCAACCGGAAATGGTTCCAGAACTCTCGCGTC
ATCAGTCAGGAGAGCCTGTCGGCCTTTCGGACGGCCATGGCCGAGCAGGCCAAGGACCCTAACCGGTTTCTGCTCAAGAC
GGCCAAGCTGCCCATGTCGCTGATCGAAGACGAGACCTCGCTGGCCAAGAGCCGTCCGGCCCTGGTGGAGTCGTTTGCCG
ATGTCTTTGGCACCAAGGCTACTCGCAAGCGGGTCACCATGAAGAACTTCAGCTCTCTCGACGACCTGGCCGACACCGCA
AAGCGGAGTATCTCGTCGTACCATGACCGGCGCTCGAACTTGGCCCAGAACGGTCTGACTGCCGCTGCAAGCGGTGAGAC
GACTGGCGAGGTCGAGGATGTCGATGGAGCAGATTTTGCCCCTCCTGAAGTCGGCGAGGCAGAGGACGAAGATGTCGGCG
GCTCCTCAAACCGGATGGAGCCCATCTTCAACAAGGGCCAGAGCAGACGGATTTGGAACGAGCTGTACCGTACCATCGAC
TCGTCGGACGTCGTCATCCACGTGCTAGATGCCCGGGATCCAATTGGCACGACATGTCGAAGCATCGAAGACTATCTCCG
CAAGGAGGCACCTCATGTTAGTGCCCTTTCTTTACTGGCTGTTTGCTAGTTTTAAAACTAACTATTCGTTATAGAAACAC
CTAATCTACGTCCTGAACAAAGTGAGCAACACTGCATGGTATCACAGACTCGACTAAATTGCTAACCGGACTGTAGTGTG
ACTTGGTTCCCTCAGCCGTTGCTGTAAGTTTCACTATACTTTCCTTTTATATTTTGGCTTTCTGCCCCATATCTCCAATC
CCTTCGCCATATACATGGCACCCCAATGATTAAGTCAGGGGACCTACCGCATGCATTTTTGCAGCAGATCATGGAAGGTC
ATCCGTTACGGCATTGGGAGATCGAAATTGAGCCCTCGCAGCCCTTGGCCTTTACATGACCATTGTGTTGTTGATAGCTT
CCGTCTTGGAAATCTATCGGAGAGCGAAAGTTTACATCGCTTTTGAGTTGAAACCCGCCGTGTCCATTCTGGATGCCCAC
TGGTGGAGTTTCTTAGTAGTGATGCAGACACTGCAATTATGAGCTGTTGCCATTTCTGTTCTACGACGAACAAATAACTA
ACAGGCAACAGGCACGTTGGGTCCGGACTCTACAAAAGACGGTGCCGACTTGTGCATTCCGCGCATCGGTGTCCAACCCG
TTCGGCAAGGGATCTTTGATCTCTTTGCTAAGGCAGTTCTCCTCGCTGCACGCAGACAGGAAACAAATCAGTGTTGGCCT
GGTCGGCTATCCCAATGTCGGAAAAAGCTCCGTGCTGAACGCTTTGTTGGGAAGAAAAGCGTGTACCGTTGCTCCTATTC
CAGGAGAGACCAAAGTGTGGCAATTTGTTCGACTGGTACGTTCCCCGATTTGTAATCAACAGCCCCCTATCTGCCGCTAA
CAAGCTTTGCTACAGATGAAGAGAATATATCTGATTGACTGCCCCGGTATTGTCCCGCCAGACCAGAATGCTTCGGCAGA
AGATATCCTTCTGCGCGGAGCAGTTCGCACAGAGAAGAGTAAGCAATCACAGATCTAGTTTCTAAAAATTGTTCACAGAT
CATCCGTCTAACGGTTTGCTCTAGTTTACAACCCAGCACAGTACATTGGAGCCGTACTGAAGCGGACAAAGAAGCACCAT
CTTGCACGCTCATATGAGTTAAATGATTGGGAGGACGATGTCGACTTCTTGGAACAGCTTTCAAGAAAGCGTGGTCGGCT
GCTAGCCGGTGGTGAGGCCGACCTCGACGGTATGGCGATCATCGTGCTGAACGATTTCCTGAGAGGCAAGATCCCATGGT
TCTCGGCACCAGAACTGTCTCCGGCAGAGGTCAAGCAGAAAGGTGTCGACGGCCGCTCTGGACGTTTTGGAGAGATGAAG
CAGAAGCGCAAGCGGGAAGACGTGGAGAGCGAGGCAGCTACTCCTATGGGCGCTGCGTCGCCCACCAATATTGCTGATGC
CAGCAAGGATGAGAAGGACGGAGAGTCTGACGGCTTTGGCAGCGACAGTGCGCCAAGCTACCTCTCGGACTCTGATGACG
ACGATAAGGATGTCAAGGACAATGATGACATGATATCGTTGGGAAGCTTAAGTGATGAGGAGGAAGATGCTGATGACAGT
GGCGATGACGACGATGCTAAAGGCGTCAGCGTCGAGGAGGCTGTCAAGGCAGGAATATCGGCCAACGTCAACAAGGCAAA
GTCAAAACAAGGCGCAAAATCCAAACGCCAACGCCGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62