GenePrediction:GLEAN_3923 Details

Name: GLEAN_3923
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1709535..1713114 (+ strand)
Length: 3580
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1709535..1712563 (+ strand)
Length: 3029
Type: CDS
Source: GLEAN
Position: GCSC_113:1712633..1712689 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_113:1712758..1712949 (+ strand)
Length: 192
Type: CDS
Source: GLEAN
Position: GCSC_113:1713012..1713114 (+ strand)
Length: 103
>GLEAN_3923 class=GenePrediction position=GCSC_113:1709535..1713114 (+ strand)
ATGTCGGCACCAGAGAGTGGCCAGCGCGAGTTTTCCTCGTTGAACGAGGATGACTGGAAGCGCAGGGCAAATGAAGATGA
GGAGGCCATCATGCAGATTCTGAGCGGCAGTCAACAGGGTGCTGAGGGTGGTAGCCTCCCAGCCGATCTTTTGAACATCA
AATTCAGCCAGGAGGGCAAAGCACACGATGCCGAAGACTTCGAAGACATCAGCGACGACGATCTACCCGAAGAGGAGAAA
GCGACACATAACACCTCTGGAGACTTGCCTGGCTTGACCGATGATACGGGTGCGAGTAATGAAACAGATGATTTGTTCGG
CGACCAACTTTCGCCCACCCACGATGGTGGCTTCCGGCTATCTCCAGTACCGGGTAAAGAACTGAGCGACCTCGAAGCCG
CATATGATGCTGCCGTCGACAAAGCTTTTCGCGGCGATGGCAATAACGACAGCACCACAACCACTGGCTTGGAACCGGTC
GCTGCCGACGATCCTTTTACTGTGACTGATAGGGACCGTGCTCTCAACTTCCCCGAAGACTACGGACACGATACGAACCA
AGATCCGAATATCCCACCCGCTGCCGAAAATCTCATCGACCTGGTGAGACTAGCCTTTCCCTCGTTCGAAAAGGGCAAGA
TCCTCAATTTCAACGAACAACTTGCGCCGAAACCACTATTTCTATCCGAGAAGAAACCAACGAAGCCGCCGAAGCCCCTC
ATTCCTGCTAAGCTCAGTATTGAGTTTGAGGCGGACCAAGAAAAGTTGTTTCGCATCCCAGGGACAGCCCAAGCAAGTGT
GCAACATCGGATCCAAGACGCCGCCGCGAAAGGTTTCGTGTCATTGCTCCAACCTGAGCCCAAAGATGCCGATAACGGCA
ACATCTTCTTTGACTCCTTCGGTGAAGGCGATGAAGACTCACCCGTCGGTGGTTTCCAGCTGAAAGATTTCTCCATCATC
TGCGCCGACTGGGACGACGTCGCGGGGCCTCTGACACCCCCGGCAGAAGATGATGAGGCTGCGGCCGGTTCTGTGCCAGG
AAAGCGAAAGCTTGGGAAGGTGGCTGAACAGAAGGAACAGGACGAGTGGGAACGCGAAATCCTAGGATCCATGCCGATGG
TGAAAAAGCGCAAGATTATCGTCGAGCGTGGCCTGCCTGCTATTGCTCGCTATGTAGCGCCGTCTTTTGATGCGTTTGAA
GAAGCCACAGCGCGAGCTGCCAAGCGCGTGTATTTGGATATGTCTGACCACAGGCTGCTTCTGGATGACGCCGACGCTGG
ACGCGCTGCCAAGCGGGTGAAGACGACGACCCCGGGCGAAAAGCGGCTGCCGAACGGCCGCCTGGGACGCAGTCTGGCGG
CCCGGTTTAACTATTCGAACGACCAAGCTTACGAGCAGCTGAAAGAGAACCACCAACACCGTGTACGGGCGCAGCTTAGC
AACATCCAGGTTGAGCACAGCATTCCAGCTCTCAAGCTGTTATGGCCTTACTACGCCATCACACGTTATGGTCCGGAGCC
GCACGATTATCATCGCCCACAGCTCAAGGTCACTAAGGGTATCGGCTTTTCCGTTCGGGTTTCCAAGCTGCACAAGGTGG
CAAAACGGGAGTGGAAGTTTAAGAAGATCCAGGAGATATTTGCACAGTCCAAGGACCTGACTCTTGGCGACAACTCGACC
GCTGTTCTTTTCGAATATTGCGAGGAGATCCCAACGGTCATGTCCAATTTTGGCATGGGAAACAAAATCATCAACTACTA
CCGGCGCAAGTCCAAGGTTGACGAAGAACGCCCACCAAAACCGGACTTGGGCGAACTGTCATTCCTTTTGCCAGAAGATA
AATCGCCGTTTTCCAATTTCGGCTCTGTCGACCCCGGCGAGACGGTTCCTACCTTACACAACCCCATGTTTCACGCGCCC
ATTTTCAAGCACAAAGCGCGGTCGACGGATTTCTTGTTTGGCCGAACACACACAAGCCAAGACGGAACGTCTTACTACCT
GCGTAAGATCGATCATCTCTTCGTGGTCGGGCAGACATTCCCCCTTGCCGAGGTTCCAGGCCCACACTCGAGAAAGGTCA
CTGCCCTCAGCAAGAATCGGCTGAAGATGGTGGCCTACCGAATGATCTCTAAGAACGGATCAGTCTCGTTGTCGGATATC
ACATCGCATGTCAAGGATTCGAATGACGCTCAGAACCGGCAGAAGCTCAAAGAGTTTCTTCACTACGACAAAGAATCGAA
GACATGGGGTCTGAAGCCGAACGACACGCTGATGGATCTGGCGACAATTAACAGTATGATCAAGCCAGACGATGTTTGTC
TACACGATGCAATGCAAGTAGGCCAGAACGAGCTGGCACAAAACGGGTACCAGCTCGACGACAACGCTGCGCTCGATGAC
ATCGACGATGAGAATGACAAGGAAAACATGGCTATGAGCATGGTACCATGGAAGACCACAAAGTCATTTATCGACGCCTG
CGCAGGAAAGGCTATGCTTCAGCTACATGGCGCGGGTGATCCAACAGGAAAGGGCCTCGGCTTCAGTTTCATCCGGACAT
CCATGAAGGGAGGGTTTATGGGGGCCATACAGGGTCCTGCGGCTACATCTGCTGACGCTATGGAGCGCGAGCGAAAGGCC
AACAATGGACACATGTACAACGTAAAGAAGCAGGACGCTCTTTACAATGAGGCCATCCGCAAGATCTGGACATCTCAGCA
GACCACGCTGGAAGACGAGACACCACATGACGATGAGGATGTCCAGCCACAGGACGACGAAGACGACCGGTTCATTCCGG
CCAAGGAGCCTGTTGCTACGCCGGCACCTCATCACCACGATGATGGGGTGAGCCAGATGAGTCGGCCCAGCATGTCAAAC
GCCCCTGAAAAGAGAAAGCTGCGCATCACGCGAATGTACCGGGATGAAAAGACGGGCCAAACGTACTCCAAGACGGAGAT
TGTTCATGACCCGGGCGTCATCTCTCAATACATGAGACAGCGGGCTTCAATTGACATGGAAAAGATTGAGTATGTGGCCA
ACGTCCTTGGACCCCTCCCCTCTATTTCTTTTGTAGGCAATAGCTAACAAACTGGCAGTCCCTACTCGGTAAAACCTACC
GGTAACGTTGATTACGACCGTGTCCTGATGCAACGGTATGTGATTGACACCAATCTGTGCATAATCAAGAAGCGAGGACT
GACATGTCATTTTCTGTTTACAGACTCGAGACCGAGGAAGCTCGTCTACACCGGAACAAGGAGCGCCGGCATGCTCGGGA
AAAGCAAAAGGCTCTACAACAACAGATCCACGATGGGGACCCCGACTCGCCAGCCCCGTCGGTTGAGCGTGGAGGCACTA
CGACCCGAAAGTGTGCTAATTGCGGACTGCAGGGCCATATCAAGACAAACAAAAAGTACGTGCACCCCCCTTTTTCAGCT
ACCCATCTTCTGGCCAGCTCGACTAACGAAAGCCTAGGCTTTGTCCAATGCTCAACGGGACATGGAAGGCCGAAAAAGGC
GCAGAAGAGGGAGCGTTTGGCGTTTATAACGCACCAGACGGGATGAGTGGTCCTGCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62