GenePrediction:GLEAN_3925 Details

Name: GLEAN_3925
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1727717..1730253 (+ strand)
Length: 2537
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1727717..1727890 (+ strand)
Length: 174
Type: CDS
Source: GLEAN
Position: GCSC_113:1727984..1728321 (+ strand)
Length: 338
Type: CDS
Source: GLEAN
Position: GCSC_113:1728420..1730253 (+ strand)
Length: 1834
>GLEAN_3925 class=GenePrediction position=GCSC_113:1727717..1730253 (+ strand)
ATGGCTCTCAAAATCCCCCATGCCGGCCTCCAGCTGGAGGAGGCTTTTCACGACTCCATTGACCACCTACCCACTCAAGC
CTTCATTCTAGACTTGAGCGACGCGGTCATTGACGGCATGATCGAGTCTGTCGCCCAGGGTCACGAGATTCGCCTTTCTC
TGGGTAACACGCCGGTATGAACCCCCCCCCTTACGTTCTCTCTCTTACGCGCTGCTTTTGTTCGCATGCCGCGTCCTGAC
TGGCACTGAGCTGATTTCGTGTCGCAGACATTCCTCTACGGCAACTCCAGCCACCATATCGAAGCCACGACCGAAGACAG
CAACGATGATCTCGAACTATTCCTTGCCAATGCTGCGAGCAGCTCCCCCAAGGTTGAACGCCTTCCGCAATTCGCCATGT
CTCTCTTCCGAAAACCAGAACTAGGGGACCCCTGGGATCAGTACCGAACGGGCTCTTCCGAGGATGAAGATGATGAATAC
GAAGAGGAAGCCTCACCCGAGCCTGAAGATGCCAACGACCAGCAGTCCCACGCCGCCTTAAATACTGACATCGCCCTCCT
ACGAAGCTCACTCGCACAGAAGGAGGCTGAAAAGCAGGAGAAATCGTATGCTAGCTCATTCCCCCACTTCTACGTTTCTT
TTCTTGCGCGTTGTCGTGGTTTGTGAATATGGAGCTTACCATGTCGTTTGTCTCCTCAAACAGAACCAAGGTCATCGAGG
GAAGCGGTCCTGCCTCAAACGGCAAGAACATCAAGCGCGCTGTCGGCTCTTTGCACAAGGCGCTTTCCGGAAGACGGTCT
CCCAATGGCCGTACTTCTGTATCACCACTACCAACTAGCCCGGCCCTCAGTGCCATCGGCTCGCCCTCGCTGGCCCCGAA
CGATGCTTCTTCTCAGCAGGCTAAACGGGCCCGGGCACCCATCATCCATGAACTCGCTTTCAAGGAGCAGCCATATGACA
TATTGTGGCAGAAGTATCCCGGTGCATCTGAGGTCGACTTCAGAAACGCGCTGGAGAAGGTAGCAGACCTATATGAGGAC
TCACAGAACTATTGCCTCCGGAAGAAATACTGGAGGGAGCTCGACGTGTGGAACCATGAGTATGCAAGCAATGACGAGCG
GCAACAGGCAATCGATAATGCCATTCGCCAGTATGACAAGATGCGGCTTTCGCAATCAGAACCGGAGTGGGAGAAACTGC
TGCGGAAGGAGGAACGTGGTCAAGGACGAATCCTGAGCAAGATTCATGCTGCAATCGCCAAGGGACCGCCTGCCACAAAA
ACGAAGGGACAGCGAACGGATGAGTCTGGAGACTCTGGAGGTGGCAGTGGCAGCGGCCGCGACGACTCGGGCGAATATGG
AAATGGCAGTCACCGGACTGACGAGGAGGGAGCCGATTCCGAAAGCATCTCGGCTTCGCCGTATCAGCAAGGGGCAACGG
CTGCCAAGAAAAAGGTCTCAGCTCGAGAAAAGCGTCTACTATCGACCAAAAAGAAGACCAACCCGGCGCCAACTTCGGTG
CCATCGTCTACACCAAAGGTGTCTCCGACAAAGCCGACTGTTGCCAAGCCAAGCGCTGAAAAAACCAAGTTCAAGTCCAA
CGAATTCATCACAAACTCCGACTCGTCAGCATCAGAATCCGAGTCGATGCCACTGGCGACGGCTGTCCGGCAGTCAAAAT
TGAGCGCCGCCAACACCAAGCCGTCTGTGACCGCAAAGGCCAACACCAAGGTCGCGCTGTCTTCATCTATCGGAGACAAG
GCACGGAAGGGGCCTGTGGTTGCTCCGCCGGCTGATGTACGGAAACCCAAGCCCTCGCCTATCAAAGAGGTGGTGAAATC
GCAGATCACAGCCAAACCGTTGCTGAAAAAACGTATCCGTCAGGATGAAGACGACAGCAGCAGCAGTTCCAGCTCGGATG
GACCGCTAAGCAAGAGGGTCAAGCCTGGCAAACCGGCACCGAAGTTGCTACCCACAAAAGACCACGAGAAGTACCACCAA
CCACGACAACAACAGGCGGCGCCGCCACCAGCGCGAGCATCCAACGTGAGCCCGAATAGCACTACCAGCAGCAGCAGCAA
TCACAGCGGCGGCCGCAGTGGCCACGTCAGGAATGGGAGCGCACCTTCCAATAAGCCCAAGAACAACAACTCACCTACCA
AATCGTCTCCGCTCGCAGCCTCGCCACCAGCCAACGCCTCTGAGATTGACTTGTCTTCGGAAGAGAGCGTTCCCCCCATT
GGCAGCAGCAATACCAATCAGAAACGGAAGATGGTCAATGAGCGTCGAAATAACCTCGACGGGACGGACTCGTCGACCAA
CAATGGCAAGCCCAAGAAGCGGAAGCATCTGCCAGAAGATGTGGTCGAACAGGCACGGAAGTTCAAGATCTACTACGAAA
AATATGAAGCACTCTATAAAGACATATCCAGCCGAGATAATCCGCCAAAGGCGCAGGTTGTTTACCTGCTGGCTATGCAC
CACCGCCTCCAGTTGATGAAGGAGAACATCTACAGTGAGGCGATGGTGCGGGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62