GenePrediction:GLEAN_3926 Details

Name: GLEAN_3926
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1732249..1735759 (+ strand)
Length: 3511
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1732249..1733460 (+ strand)
Length: 1212
Type: CDS
Source: GLEAN
Position: GCSC_113:1733718..1735276 (+ strand)
Length: 1559
Type: CDS
Source: GLEAN
Position: GCSC_113:1735618..1735759 (+ strand)
Length: 142
>GLEAN_3926 class=GenePrediction position=GCSC_113:1732249..1735759 (+ strand)
ATGCCAATCAGCTTGGCTGGTCCGAAGGTGCTGGAAGAGGCCTCTGCGGATGCAGCGGAGGAGTCTTCCCGCATCTTCGT
GAAGAATTTGCCGCCAAATATCACCGAAGAAAGCCTTCGCAAGCACTTCTCTTCCGGCGGCCGTCACATCACCGATGTCA
AGCTCATCACCCGGCGCCGGATAGCCTTCCTGGGCTACCGCACGGCGGAGGAGGCCAAGTCTGCTGTTCGATACTTTAAT
CGGTCGTACATCCGCATGTCCAAGCTGTTCGTCGAGGTGGCCAAACCCATCGGCGATCTATCGCTACCGGGAGCAAGTAG
CCTGAAGCGCCCGTACGAAGGGCAAGAGGCAGCTCAGGAGGATCCACAGAAAGTGGCGGAGGAAGATCAATCAAAGAGAA
GGAAGCTTGACGAGGCCGATCCCAAGCTTCGCGAGTTTCTTGAGGTGATGAAGCCACAGCATGGCCGAGGCATAAGCAGC
ACGGCAGATGTCTTTGCAGCAATGGGTGATAGTCAGACGGCACAGTTGGAAAACAATGCCGCAGAGGCCGCTGCAGCGGC
CGCTCTAGCTGCTGCTGAAGGAGAGAGCGATGACGAGTATAATTTGTTGCCAGCACAGCAAGCTAAGAAGAGGAAGGAGG
CTCTTGACGACGACCCAGACACTGTTGAGACAGAGCCGAAAGCGAAGGACGCCACTAAAGTAGTCATTAGCGCAACTGCT
ATAGACGAAGTCGTCAAGAATGCCACGGACAGTTCCAGCTCAAGAGTGTCGCAACAGGAGGCACAGCAACGAGAGCAGCA
ACAAAAACAAAAACAAGCAATCGCGTCCGCGTCGGATGACGAGTGGCTTCGGTCTCGCACAAATCGGCTTTTGGACTTGC
TTGATCCCAGCGAGCTAGAGCCGCCAATCATACCAAGTATTCCGCCACCACCAGCACAGGCAGTGGCAAAAGCACAAACC
AGTCTACGGGTTGAGGCCCAGGATGACGAGGTCCACGAAGAGATCGACGAAGAGGAGAAACCGGATGATAGCACGACACC
CATCGAAAGCAAAATGGATGTTGTGGTCGAGGTGGCACCTGCATCACAAGAGCCACTCCTGCCAGAAGATCAAATTCGCG
AAACATCCCGTCTGTTTATCAGAAACTTGCCATATGATGCCACCGAAGCACACATCTGGAAGTACTTCGAAACCTTTGGC
CCCGTGAAAGAGGTATGTAGTATTTCGTAACTGGGTCGCCTGCATTCCTCCTCAGCCTTTCAATGATGAACCCCAGATAG
GGACATCTTACGTCTATTGACATGTGATGAGAACCTTGGGCCAAGAATTTTAGTAGATTTTTGTTGTCTGAACGAAAGCG
AGGAGCATCCTTTTTCAAAAGAATGCAGTTTGATTTGCTCATCTTATTACTCGGCAACGATACACATTCCAGCCTGTTAA
CGCTTGTTCGTGTCGCTTCCCGCTTCTAGGTGAATCTTCCAGTGACCAACGCTGGTGCAAACAAGGGATTTGCAATGGTG
CTTTTTGCCACCGCGGCATCGGCGCTGGCAGCATTCCAGAATGGCGACGGCAAGACTTTCCAGGGTCGCATCCTTCATGT
ACTTCCAGCCAAGGCAAAGAAGTCAGCCACAGATGTGGCTATGGACGAGTTTGCCATTTCCCAGATGCCGTTGAAGAAGC
AGAAACTACTGCGGAAGAAACAGGAGGCAGCAACCAGCACGTTTTCGTGGAATGCTCTCTTCATGAGCCAAGACGCAGTG
AATGCGGCAGTGGCGGAACGCCTGGGCGTGTCCAAGTCAGAGATGCTAGACCCGACCTCGTCTGGCGAAGCTGTCAGACA
GGCGGTTCGGCAAACGTCGATAATCGAGGAGACCAGGAGCTACTTCGCCGCCAATGGTGTCGATCTGGACATGTTCAAGC
CGCATACCAAGCGGGGAGACAGGTGCATTCTGGTCAAGAATTTTGCTTATGGCACATCGTCGCAAGAGATCCGTAGCATG
TTTGAGGAGTTCGGACCTGTGGTTCGCGTGCTCATGCCTACGGGCGGCACCATTGCGATTGTGCAGTTTGCGCAGGCAGC
TCACGGCCGACTGGCATACTCACGGTTGGCTTACCGGCGAGTCAACGACACGGTGCTCATGCTGGAAAAGTGCCCGGAGA
ACCTATTTGGGGACAGCACGCACGGCCAGACTCTACAAGACACTGAAGTCGGTGCTAACGACCAGAAGGCCAAAACAAAA
CGCCCCAAGGTGACAGCCAGTGAACTTCTTGGCGAACAGGTCGAGACAGAAGACGTCGACGATGCAGCAGACACGGAAGC
TACCACCAGCTCGCTGTTTGTGCGGAACCTCAACTTCACAACAACAACTGAGCAGCTGGCAGGGGCCTTTTCGAGTCTGG
CAGGCTTTGTGTCTGCCCGGGTAAACAGCAAGCCGAACACCAAAAAGCCGGGCGAGACGCTAAGCATGGGCTACGGCTTT
GTAGAGTTCCGGACCAAAGCAACAGCAGCAGCAGCCGGCAAAGCGATGGACGGCTTCATCCTGCACGGCCACACGCTGAC
GGTGCAAGCCGCGCATCGCGGCCAGCAAGACGCAGCAGCCGAGCGGCGGGAGTCGGACCGGAAGAGAAAGCAGGCGGCCA
ACGGGGGTAGCAAGCTGATCATCAAGAACTTGCCGTTCGAGGCGACGCCAAAGGACGTCCGCACACTGTTGAGCACATAT
GGACAAGTCAAGGCGGTTCGGCTGCCGCGCAAGGTTGGCAACGGAACGCGCGGTTATGCGTTTGCCGAGTTTCTCACAGC
GAGCGAGGCTGCACACGCAATGGATGCGCTGCGCGATACGCATCTGCTCGGACGGCGGCTGGTGCTGCAGTACGCCGAGG
CAGAGGCTTTGGATCCGGAGGAGGAGCTGGCCAAGATGCGCAAGAAAGTCGGCTCGCAGATGAACACAGTGGCGCTGCAG
CAATTGACGACCGGACGCAGACAGCGGACGAAGGTGCATATAGGCGAAGAAGGGGCCGAGGAGGGCATGTGAGTCTGGAC
TGGGCAAGTTGGAAGGGCGAAGTCCAAGGCGAAGAAAGGGAGCTCAACACAGGAATGAAGTTATATGAGACGATAGGGAA
AACAGGCGTGCCCGGAGGCACCCCAGGGCTATATGGGATATTATGGACTGTCTTATTGCATAGGAAGGAGTCGCCATTAT
TGGAGCGTGGAGGAATTGATTTACTAGGGCTCAGGTCGAGAAGTTATCCCGTTCCCTTGACTCGTCGATGCATGTGTGAG
AAATGTCTTGTGGGGTGCAGTGTGTGAGAAGAAGGGACGGGAATAGACGCGCACTGACACGCCTTCGCATGGCCGTTTTG
CTGCTGCAGAGTGGAGCCTGCGAAGCCAGGGAGGACGGCCGGCCAAATCGAGAAGGAGCGCGTGTCGCTGCGGAGAACAG
GGGGTGGCCGTGATAGGCCGGCGCGACCGGCAAAGCGTGACGAGAGGGATGGCCAGAGGAAGGAGCGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62