GenePrediction:GLEAN_3927 Details

Name: GLEAN_3927
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1737401..1740701 (+ strand)
Length: 3301
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1737401..1738046 (+ strand)
Length: 646
Type: CDS
Source: GLEAN
Position: GCSC_113:1738102..1740701 (+ strand)
Length: 2600
>GLEAN_3927 class=GenePrediction position=GCSC_113:1737401..1740701 (+ strand)
ATGGAGGTTGTCTGCCCTGTGCTGCCTTCGCAGCATCGTCTCCCGCTTCAGGAGGCTACTGGCAATGTGCAGTCTCATGC
CAGCAACAACAGCAACAACACTCTTGCCTACTGCTCTCCTGTCACTGCCTCACACTCTTCACCAGCTTCCACCTCTTCAT
TGCCATCCAGCGCACTTCCTTTAGTGTCCTGCACACAGGTGTCATCAGTAGCAGCATCTTCCATCCCATCTGCTCCCATC
CTACCTACCCAGTCTCTCGATATTTCTCAGCACAACAACGTCTACACCTACCACAGCCAACATACGCAGCCTACTTTCTA
CCCTGAGGCGCTCATCAAGCAACTCCCTTCTCAGCAATACACCCAGCACTCCGCTCATAAGTATCAACAGCAGCAGCAAC
AACAACAGCTGCTCTCCAGACGCCACTCTATTCATCATGGCAGTCTTGCCCTGGGTGGCGGCTTTCCTGGCGGCAGCGTC
ATCAGCTCCAGCAATGGTCTTGGCCCTGCAATCCCGAACGCGAATGCCAACGTCAACCCGATCTACCTGTCTCCGCAATT
CCAGGCCTACCGCAAGAAGCAGACGGAGAAGGACGACAAGACAGAGCAGATCTGGCCGGATGTGCTCGAAGATGCGTTTC
TTGATGGTAAGCATCTTCAGTCAGCGAAGTTGTCTGAATTACCTACTGACAGTCTTCACAGCCCTTCTGTTGATACCCCA
GATGGGTCGCAAGAAGTACGCAATGCGCGGACAGCTGCACGGCCGCAACATGCTCATCAGCGAGTACCTCTGGGTGGCTT
ACTGCCTGTCTCTGCCGGCTGGCGTCAAGCCCGACAGCAAGATGGCCCGTGGCCGCAAGCAGGTGTCCAGCCACATCCAG
GTGCTCAAGAACTTCTTCATCCACCATCGGTGCTACCACTTCTTCTTTCCCAGCAAGGAGAAGAAGGAGGACACGCGCAA
GGACCTGCTTGAGAAGGAGTCCTTCAAGGACAACCGGGTGCTGCGTGCTCTGTTTGATGGACGTCTGCCCGAGGAGCGGC
CCAACTACGAATACTTTGGTCAGCTGTTGGCGTCGGACGGACTTGTGGCCATTCGGCCAAGCCTCTGCTGGATCCTGGTG
TCATCCGCGGCTGTGCGCTATGAAAGTGACGGTCCCCATCGCGGCGAAGCCACCAAGCCCGATGGCTTGCCACTGGATGG
GCGCGTGTACCCCCACCTGCACCTCAACAACAAGCGTGAGGAGTGGCCAGAGCGTGGCAAGATCATCCGCGGAACGCTTC
TGCAGGAGTACACGCGTGCTCTGAGCCAGAAGGAGGCCAGCTCGGTGCGCGATATCTCGCAGGACTGGAAAGACCGATTC
CCCGGTCAGATGTGCGAGGCGCTGGACCAGGTTGTGCGCGAGGATCTGCGAGACATTCTTCATTTCCATGTCACGCTCGA
CGTACAGGAGCCAGACCGGTTCCCGGAGGGATCGGAACTGAACAGCCTGGTTGAGGTGACGATTGAGCAGGCGTACCTGC
AGAACCACCGGTGGAAGTCGGTGACCCGGCTGGCACGGCCAAGCGAGCTGGTGCCAGGCCGGCCGGACGACGAGGAGACT
GGCAGCAGCGCCAACCAGGTACCGGTGTCTGTGATCACGCGTGACATTGGCAACCAGTACATGCACCGACCAGGATGCCA
CGGCGTGGGCAACGGCGGACACTGTGACTGCTTCCAGAGTGCCCGCATGCGGCGGCAGCAGTTGGCTGTGCCCTTTCCGG
CCCCTGAGTGGGCAACGATGCTCAGCATGCTCACGGCATACCGCAGACACCCTCTTGAAGAGGATGGTGGTGAGGCGGCC
GGTGTGTACGCCTCGCGTGCCAGCTCCAAGAAGAGCAGTGGGAAGCGGTCGTCTTACGGATCGACAGCGACGTCGGCGTC
CACTTCGACCCGCCGCCGCGAGTCGGACAGATTCACCGAGGTGGGTGATGACGTCGGTGACGATAGCTTCACATCGGCCT
CGTCGGCCGATAGTACCGGCAGCAACGGGACTCCGACCCAGATGGACCTCGTGCGCAACATTGCGATGCTGCAGGAGCTC
TGGTCATGTGACCCATCGTCACCTTCTTCCACGCCTAGCGAGGACGGCTCGTCGGCCCCGACTTGGGTTCGCCGGGCAGT
GATTCTGTGGACGTTCGAGACGGTCTACAGCGTCAACGAGCGCAAGATGGAGGTGGTCAAGATGCCGGCTGGCACAGGTT
GGCGTTTCCTGACGACGATCGACCCGGCCTCAGAGTATCACCAGCGCCAGGCTCTCGTGATGCCGGGAAGCAAGGGCATG
GACGGGCATCGGGAACAACAGCAGCATCACCAGCAACACCAGCAACACCAGAACCACCAGAACCACCAGAACCACCAGCA
TCACCAGCATCACCAGCAGGTGCCATCGCCGCCGCATTCGAGCACGCCGCAGCCGTACCCGATGTCGTACCAGACGCGTC
GGGACAGCGACATGTCGCCTCATCCCGGCTACCACCAACACCTGACGGCAGCCATGAGCGAGCACCTCAGCAGCAGCTGG
GACCCGAACGGCAATGCAGGCGACTACCGCCAACTCTCGCCACCAGAGTCGTACCAGGTGCCGGGTCCCCTCGGACTGCT
CGACACGACGTATGGGGCCGGCCTAGCCACACCGCCACCGACGGCCAGCCTGCCTTCACCGTATGCGACCACGATTGACA
ACCAGCACCAGCACCAGCAGCACCAGCACCAGCACCAGCAGCACCAGCACCAGCACCAGCAGCACCAGCAGCACCAGCAC
CAGCAGCACCAGCACCAGCAACGCCAACATCAGGCGGCCGTGCACGCCTACAACCAACACCAGCAGTCCTTCCCGGGCCA
GCTCGGCTTTCTGTCGGCTCCTTCACCGGCTGACACGGAGAGCAGCCGAAGTCAGGCAGCCGCTGCTGGAGGACACACGC
AGCCTGTGATCGACCCGTTTCTGGCGGCAGCGGCGGCGGCGGTGGATTCTGGCAGTAGTGGCAACGGCGGTAGCTCGCTG
CCTGACTGGGACACGCACGATGTGGCACAAGCCTTTGGAGGCTGGCCGGTGACAACAGGTGGCAGCACAGCAGGCGGTGC
CGGCCCGGTGACAGCCAGAGGACCCTCCAGCTGGCAACAGCAGCAGCACCAACAGCAGCAGCATCAACAGCAGAACCGCG
GCCTGAAGCGTGGACGCTCAGACAGTCTGGACGATACGAGCGGGTATCCGGTGGCCAGCATGCCGAAGCTCAGCCATAAT
GGGTTCAGCAGCTGGCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62