GenePrediction:GLEAN_3929 Details

Name: GLEAN_3929
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1749322..1750936 (+ strand)
Length: 1615
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1749322..1749575 (+ strand)
Length: 254
Type: CDS
Source: GLEAN
Position: GCSC_113:1749655..1750936 (+ strand)
Length: 1282
>GLEAN_3929 class=GenePrediction position=GCSC_113:1749322..1750936 (+ strand)
ATGCATATTCTCAGCCAGATAACGGACAGCGCCGCACTTCTCGCTCGTCAAGCAGCCTCAGCTGCCACAACATCCTTAAC
AAGCGCAGCAGCTACCACAGCCACAGCAGCTGGCTCAACGTTCCCCACAGATACTGCTACAGCGGCGAATGCTACATCTA
CTGGCAGTAGCGGTGGCAACGGCGGCGGGGGTGGAAACTCGCCATTACTTTTCTTCGTGGCTCTTGGCTTTGGTGTTGTT
TTCACAAACCTCTGGTGAGTAAGCGCTGAAAATTGAGACAGACCGTACTGTTGGCGGTATATACTGACCATGGTGCGCCT
TATTTTCGTGTAGGATTATTGTCGGGGTGAAATATTGTTTCCGCTACAACGCCAGAGCCCGCCAGCTACGACAGGCTACC
GAGAACGGCGAGCCGATAAATCTCGGAAACATGCCGCGTCAACATCGCCGCCGGCGAGAGAAGAAGTTAATGACCATTGA
TGAGGTCAATGAGAAATTTCCGATGATAAAGTACAAGAGCTGGGTGGCGACTAGGGCAAAACATGGCCTATCAACACTAG
GCGGCATCGACGCCCCATCTCGCGCCAACAGTGTTCGCTCCGTGGACGGGGTCGTTGTCCAGCACAAGGAACGCGAGTCC
TCCGACGAGCCGGAAGAAAGCAGAAAGCAAGATAAGGTTGCTTTCACTGCAGCGAAAACCTCTGCAGTCGACGACGACGC
TCTGAAGCATACTGACACTGTTACCCCCATATCGCTCGACTCGCCGGTTCTGGAGGCGACATCATCAGTAGTCCTAGGTT
CGCCGGCGCAGGCCGGCACCGTCTCTCACAGTGAGGAGGAAGCTGCTCACGCCGACGACCTTGTTCACGACCACGACCAC
CACAGCGATGATGAGGACGATGAGCACATCGATGCAGCCCTGCCGCCCGAGTGTATCGGCACTTCCGGCGATACCTGCGC
CATCTGCATCGACACCCTGGAAAACGATGATGATGTCCGTGGTTTGACGTGTGGCCACGCCTTCCACGCCGTCTGTCTAG
ACCCTTGGTTGACAAGCCGCCGCGCGTGCTGCCCACTTTGCAAAGCGGACTATTACACGCCAAAGCCCCGCCCGTCGCCC
CAGGACATTGCCGACGGCCAGGCCACTGGTATCATCACGGTTTCTATTGGAGGAAATGGCGAGGTCCGCCGTCACCGGAT
CAACCTGTCCTCTAGACCCGGCACCTCCTGGACGACTTTCTGGTCGGCGTCGGGCCGCGCGCGCCAACCCGAGGCTGACG
CCAACCTCCAGGTGCTGGAGGTGGCTCCCTCGAGAGCATCTATGCCTGGAGAAAACGACAGACTCTCCAGACGCGGCTTT
TTCGGCAGGAGACGGGCAGCGACTCAGTCGGGTTCGGGCGAGCAGTCGCCTGACAACCAGCGCCCCGAGTCGACGAGGTC
TCGTAGAAGCTGGTTTGGTAATGCCCGTCCATCTTTTCCATCTATTCGGGATTTTACGAGGCGTCGGAGCGAGAACAACC
GGTTGCAGGGCGCAGCGTCTGGAAACGCTGCTGCGGCTGTGGCTGAAGTGACACCGTCTCAACTGGAAGCCGGCGCTCAG
AATGAGTCCAGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62