GenePrediction:GLEAN_392 Details

Name: GLEAN_392
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1492737..1497333 (+ strand)
Length: 4597
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1492737..1492788 (+ strand)
Length: 52
Type: CDS
Source: GLEAN
Position: GCSC_167:1492922..1497333 (+ strand)
Length: 4412
>GLEAN_392 class=GenePrediction position=GCSC_167:1492737..1497333 (+ strand)
ATGGACTTCAGCAACGGGCCCATCTGGGCTCGCACGGCCAGGCCGAACCGCCGTCTCTCCTCCACCCCATCCTAGAGGCA
CGCGGATTGCCTCTGCAGCTGTGCCGGCCCCACCAGCTTCTGGATCAGACAGGATCGCCATTCGCCCAAATCCACACCAC
ACGATCAACCGCCCCCCCTCAATAGATCGAGGACATCTGAGCAAGCCTCACAACAGATCGAGAGAGAACGGATCCACCTC
TTCGATTCCCCTACCATTCAGCTCGGACCGTGGCTTGACGCAAAGCCCGGCAGAGCTGCGTGTTGCCAACAAGGCGGAGG
TTGCGAGCTCTCACCCGGCAACCATCTACCCCGAGCTCGACAGGTATCGTCATGTTCAACCGCCGTCAGGGATAGCAGGC
AACCAGAGCGGAAGACAGCATCCGGATTTCTTATTCCGGCTTGCCACCGAAGGGCTGCCTCCACCGCCGACGCCATACAG
CTCCGGACCGAGCAGTCTGGCCAGCGGTATCAGTGGCAGCCCATCCACACGATTCTCTGAATCTCCTGGTCCTGGATCAT
ACAGTCGCGATACAACACCTACCTCGATGTCGTCTTATTCCCCTGGTGTGGTAACCTCCACCCGCACCCTCGCAGCTTCC
AAAGTACGTCAGAACAGCCGGGGGAGGGCTGGCAGTTTTGGCACAGAAGTGGCAGGTGATATAGGTGGTTGTGCTGGCAC
GTCGGCGCATCCCCTTAGCGCAATTCGTGAGTCTCTAAACTCGTCTTCCTCCTCCTCAAACGGGACCGTTCGCGATGGCG
ACAAGAAGAGCACGAGGCCAAAAAAGAAGAGACTTTCTCCCCTCCCACCGAGTCCACCACCACGCAAGTCATCGCAGGGA
TTCAGAATGCCAACCGATACAGACAAAGTTTCCCTGGCAAAGCCAACACTGCAAGAACGGCCTACAGTCGCACCACGGCC
ATCCGTATCAAGCCAGATTCGCAAGCCTGCCAAAGCGACTGCGTCTTCCAATCCAACCTCTCTGCCGAAACCACCCCCCT
CGGGGAAGTCGCAGATCGCTACGGCATCGAGGCCGGTCCCTTCACGATCCGCAACCCAGCCTGCACCACCTACTCGTCCG
AGCAGAGACGGAACACCCGATCTGCACTCGCACTTCAGATTTCCCATTCCTGTGATACACAGCAGCCTCGCCACGGCCCG
GTCTTCCGACCGGCGCGGGAGCATAGGCATGGCTCTCTCATCACAAACCAGCACCACTCTTGCCAAGCGCCATCAGAGGT
CAACTTCCATTCTTTCGTTTCGGGATCAACGCGCGCAATCTCCAGCGCGGCCACCTACTATTCGAGACCGGACAGCGAAT
CGCTCGTCCATGTCTATTTCTGGGGCCGTGCCCGGGCCCAACTCTGCATCTGGGTCTGCAAACGTCTCTGTGCGAGTGGC
GCGCCAAGACTCGAGACTAAGCGACAGTGAAGATACAGGACGGAAAACCAGAACACCAAGCCCCAGTGTTTCCACTTTCC
GGACGCGATTCCCTTTGTTCGGCCGGCGTACCAAACCGGCCCTCGTGGTGAACGTCACGGCAGCAGCAGAGCCGAAAGAA
AAGCCGCCCAGGAGAGGACCTGCCGCCGGCACTGGCCATGAAGGCTACGGTCGTCTCGGGGCCAGCCGGCGGCGAAGCAA
CAGCGCGGGAACTCTGTCTAGGGGAGTTTCGGCCTCGCAGGACAACCAGGGGAACGCGCAGGTACAGGACCCTTTCCTTC
GGGATCGGCTGAGTCCGGTAATCATCTCTGGGGGCGAGGTTGTGCTCAACAAAAACACAAGCCTGGAACTGAGCCGCACC
GACAGCAACACGAGCTTCAGCTTCTCAAGGCCAAGTCTCGACCTGCCTAATACGTCGCAAGTGTCTCTGTCGTCGTCCGA
AGATCGGTCTGCGCTTTGGCCATCAGCCATGTCCCGCGATGGCCGGCTAGCCTCGTCGCCTCAGCTCTCAAACCACCGCC
CTTCCGACAGTAGTGATTCCGAAGTACTGATACGCCCAACACTTGCCTTCCGGCGGTCTGTTCAACTTCTACATGCGCCC
AGCGAATCCCAGATCCATCTTCCAGCACCGATCGTTACCCGAGAGTCCCCACCTGGGGTGTCGTCTTCCGTTACCAGTCT
TGATACCGGCATTCTGTCAGATGATTCTACGATTGGCTCTCGGTCAGTGATTGAGCGTGGGCTCAAAGAGTCAGTGCCTG
TCAATGTCAAGGCTGCGCCAAAAAAGCTCACAAAACGAGCGAGGTCACCCCGCAAATGGAACATGTTTGGGCGTTCCCAA
AGCCAGCCTGCGTCCCTGAAGAAGAGAGCCGAGTCCTCATCAACCGTCACGGTCACTGTCGAGGCCGCCTCTTCTGTACG
AGAAAAGAAGCCGGTTGCATTCTATACCATGATAGATTCGTCTGAGCAAGAAGATGGCGATACGGACATGGAACACGTTC
TTCGTGAGGCCCATGCCTTGCAGAGCCCAACGCCAAAGCCTTTGGATGAGCAAACTGGACTAGTTTTGGAAAACAGTACG
GTTTCAAAGGAAGATTTACTGTTGCCACCGCCACCGCCGCCGTTGATCTCCATTCTGCCAGAACAGCAGATGGTCCCGCA
CGAAGACCAGACAATCCAGCAACCTCAACCTCAGCTGATCTCAAGCCCTCAAGCTCCGTCGGAACACGGTTCCCCAAGCA
CTTTCCTACAGACATCCACAGCACAATCCGAACGTCCAAGCAGGCTGCAGCAGGTTGGTCGGATACCTAAAGTCGTCAGC
GCCAGACAAGAACAATCATCTCCCTGGAGCTTTTCCAGGCCGTTCAACCGGGCAAGTATACAGGTCCCGGCTTCCCTCGA
GATCATTCCTCGTGCAATCTCTGCGAAAGATACTCCGTTGCTAGAAAGCTCGCTTCAAGTCAATCCCGCAAGTGACAGTA
CTGAATTTCTTGCCTTTCCACCACGCCATAATTCTGGAACGACGACGACCTCGAGAAGCTCGGGTGTTCTTACCTTTGCT
GACTCCACAGCGATTGTACCGGACCCATCTGCTCCTCTGTACGAAGACGAGGTTTGGGACGAGTATGACGATCTTCTTGG
TGAGGACGAAACGGCAAAGATTCCGCTCTCGCCAAGCTCTTCGCATGGCCTGCCGTTCCATCTCGAAGGGAGTGTACCAC
TGTCAGTGAAGGCAATTGCCAGGCAGATCAAGCTGGAGGACGAAGGACTGGAGTCGCCGACTGTTGTGATCCACCCACGA
ACCGAAGTTGCGGGCGAAGTGACGCGGCAATATGCTCGGCCTACAATTACTAGTAGCGTGTGGGGATTCGACATGGCGGC
TCAGTTGCATGAAGCTATTAACGGCTGGGGTGAACCGCCATCTGGCCAGCTTCCTCCGACGCCATTTTCCGTCTCCGAAT
TTGTGTCCGGATATGGCGACCGAAGCAGTGGACTCAACGAAGAAGACAAGGCAGCTGGGCCACGAAGAAGCAGTGTTTCG
TCCGAGCGGAGTGGGCCTCAAAAACCACGAAATTCGGACGGCAGCGTTTACAGCCAAGTATCTGAAGACAACTCTCCCAC
TGCACAGGTCAATTTGCGGGTCGGATCGATGACGGTCAGCAAGTGGCTTACGTTTGGACATGTCCTCTTCAGTCCTGCTC
GTGATGACATGGTTCCGGCCGTGAGTCCCCCGAACGGACACTCGGTCCTCGTTGTCGACGGCCTCGGCAATGACGACTGG
TCGTTTTATGCTGCTGAGACGTATCCGGCCGCAACATTTTTCAACATGTCTCCGCGAGCTCCGTTGCCTGCCGGTCATGG
AAATGGGGCCACGACGTTCCCGATGAGCCCGTCCAACCATCATCAGATTCAGTACATGTCTCACGCGGACAAGTTCCCTT
TTGCGTCGGAGATTTTCACGACTGTTGTCTACAGGTTTCCTCGTGCAGCTCCGGAAAGCCATTACAGAAACATCATCAGC
GAAGCCCGCCGTGTATTGCAGCCGGGTGGCTACATCGAACTGTCTATCTTGGACCTCGACATGAACAATATGGGAAGCCG
CACACGCCGAGCCGTACGCCAGATGAAGGAGCAGATCCATCTCCAGACACCGGATGTGCATTTGGGGTCAGCAGCCGACG
CAATACTCCGACTTCTAGGAAGCAAAGGCTATACGGACATCAAATCCTGCCGTGTCGGTGTTCCAGCAGCAAAAGCGATT
CCACGGTCAAGCAGCGAGATCAGCGTGAACGGCACAGCCAGACCTAGAAGTGCAGGGAAACGGAAGAAGGACAACCGCAG
CCTCTCGGAAATGATTAGCGACCAGAGCCCGGTTGCCGATGAGAGCATTACGAACATGGTGGCCCGGGTTGGGCGATGGT
GGCACGGCAAATGCTACGGAGACATTGCTGCTGCAGCCAAGTCTCCGTCTGGGTCGATAGACAGCAACGGGTCCGTCAAG
ACGGACATGTGGACGGATCGTGCCGTACTAGCCGAGTGTGAGGCGTGGGGGACGAACTTGAAGCTCATGGCTTGCTATGC
GCGTGTGCCGGACACCAAAAGAGTCGCCAGTATTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62