GenePrediction:GLEAN_3933 Details

Name: GLEAN_3933
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1768747..1769244 (+ strand)
Length: 498
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1768747..1768782 (+ strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_113:1768866..1768924 (+ strand)
Length: 59
Type: CDS
Source: GLEAN
Position: GCSC_113:1768994..1769080 (+ strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_113:1769193..1769244 (+ strand)
Length: 52
>GLEAN_3933 class=GenePrediction position=GCSC_113:1768747..1769244 (+ strand)
ATGATTATCCCCATCCGGTGCTTCTCCTGCGGCAAGGTCAGTTCTCCCTTCGCCTCCTGTCCTGCTCGCAGACAGGCCTT
TTCGATTTCTTCCAGTGCAAAGTTCTGACGCGACAATAGGTGGTCGGCGATCTCTGGGAGCGCTACCTCAAACTTCTAGA
CGACAACGTTCCCGATGGGTAAGAATATCACCGCGAACCGCTCCTAGCCACATTAGTCGATGCGTCAGGGCTGACATACG
TCTCTAGCGACGCCATGGATCAGTTGGGCTGCAAGCGGTACTGCTGTCGGCGTATGATCATGACACACGTGGACTTGATT
GAGAAGCTCCTCAAGTATGTACACATCCCCCACGAGCTGTGGAGACCTCCCATATGCCGGGCGTCTATCTCACCTTGCTT
CCCCTACTGCCTCATAGTTAGTGGCCCTCTCTAATGTTCGCTTTAGGTACACTCCGGACGGCCGTAGCGAGAAGAAGATT
GCTCTTGCCAACCAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62