GenePrediction:GLEAN_3934 Details

Name: GLEAN_3934
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1773730..1776310 (+ strand)
Length: 2581
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1773730..1773836 (+ strand)
Length: 107
Type: CDS
Source: GLEAN
Position: GCSC_113:1773892..1774084 (+ strand)
Length: 193
Type: CDS
Source: GLEAN
Position: GCSC_113:1774150..1774248 (+ strand)
Length: 99
Type: CDS
Source: GLEAN
Position: GCSC_113:1774302..1774391 (+ strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_113:1774453..1774603 (+ strand)
Length: 151
Type: CDS
Source: GLEAN
Position: GCSC_113:1774669..1775068 (+ strand)
Length: 400
Type: CDS
Source: GLEAN
Position: GCSC_113:1775161..1776310 (+ strand)
Length: 1150
>GLEAN_3934 class=GenePrediction position=GCSC_113:1773730..1776310 (+ strand)
ATGGCTGTTCAAGCGACTTTGCGATCTTCTACTGGGAGCATCACCTTCTCTCAATCAGATCTGCCTATGTCCCCTGGATC
GCCCGCTGGAAACAAGCTATTGGCCATGTATGCTAAGGATGAGACGACCCTTTTTCCCCTTCTTTGCTAATCATGCTGCC
AGGTCTACCTCATCTCGTTCCAGCGCCGATTCGCATGCGCAGCAATACCAACAAAATTTCCGCAACTTGTCGGCGCAATT
CATGAGCCCAACGAGTGATATCGGACCGTCTCCCGTAACATCAAATGGCACAGAAACAACAGAAATCGAAGACGATGAGG
CCGAAGACAGCATTGGTGACCAGCGAAACTCTCAGGTATGCAGCCCGTTACCACGCTGGGTGCCCACAAAGAACGCTTGT
CGCTGATCACCTGTCATCAGCTCATTATGCTCAGAACAAATCTTCCGAGCCACATACGCCAGGCTTCAAGCGAGGAGGCG
GTCTCTGTCATCCATGCGCCGGAGAGCTTTCATTCTTGGGTAAGCGTAAAATCATTACTTTTACTGGTCATTGCCACTAA
CACACCTATTAGATGGAGACCAACTCAGGAACAACAGTCCAGCAAGGGGGCGACAGGGTCTCGGGGATCATCAGCCCCCC
AGTCAGCGAAGCAGAAGACAAGGTAAACCTTCTGCAACTTCAAATCACACAGGCAGCAATGCTGACCACACCCGGTACAA
CAGACCCACCAGTCTCAGGCCCCGCCACCTATCTCAACAGACGTGAAGCCTGTCAAGTACAACATCGACTCGGCCACACC
ACAGGCCCAGACCCTCGATGACATCTTCAACGATCCTTCGAGGCGTCGCTCATCGAGCGCTGGTGGGCTGGAAAGTACGT
GCTGCTCCTGCTTGGAAGTCTTGACCTAGCCTTGAATTTGTGCTGAACAAGTGACACAGACATCCCGGAGAGTCATGAGT
CTGACCTCTACAATGATCACGGTTACGACGACTATATCACGAGCCCCCATATGGACGGTGGCGGAGAGATTGTTGCTCTG
CGAGCAGCTCTCGAAGAGTGCTGGACTCTGTGCAATACACTTGCAAACCTCAGCTCCATTCACCGGGAAAGGGTATTTAA
CAGCTCTGGAACCCCAGATGCACATGAGAAGGCCTGGAAATGCTGCTGGAAACTGTGTCAGCGGCTCTACCACAGCCGAG
ATGAGGCTTCCGAAAGCTTCAGTGTTGGGACCAACCTCGACCTGTGCCGCGATTTCTGCCAGGCGCTATTTGATGTCCGC
CAGCGGAAGGACCCGGGTGCTGACTCTGTCTTTCGAGTCTGCTACGAGCTCAATAACCAGTATGTAGATCCCATGTGTCA
CGCAAACCTTTGCTGTTTGCTTCCGTGTTTGTATCTAGAACGACTATGCTAACTTCAAGCTTCCTTCAAAGTCTATATAG
CGGCCAGGATTGGCAAAATCTGCCCGAGCCGTTTAAAGAACGAACGCTGGATTTCTATATCACGCTCTGCCACCGTCTGA
TGAAGCAGCGCAGCGAGCTGGCCGAGGAGACCGACTCGCTGCTGCGAGCGTGCTGGTCTTTGGCAGAGATGCTCTTCAGC
CTGCGGCAGAACTCACGCGATGGCAAAGCCCCAGACGAGGAGCTCCTCGGATCGGCTGTGCAGGCCTGCTGGGAGCTATG
CGACATCTTCCGGGAAGGATGGACACAGATACGACCAGACCGTGGCACGCCACGTCCAAGCCAAATCAACTTCCAACAGT
CGCTGCAGCAGCAGCCGCAGATGATGGACACTGCTAGCATTATGTCGTCCAACAGCCGGGTGTCCAACCACTCGAAACGC
GACAGCTTCCCTGGCTTACAGGATCGGCCCAGCTCTGTGGCCTCGACACGGAAACTACGAAGCTCGCAGATGCAGGCACA
ACCACTGCCAACACCACAGATCCCCGAGACGCCAGTGACCGAATTTGAGGACACGCCTGTCTCACCCGAAAGCTCAAGTC
CGCAGATGCCTAACATCATGGTGCTGGGAACAAGCAACAGCAGCAGCACGGACCTGTCATCGCGAGGAAGCCATGGAGCG
AGTAGCAACGGTAGGCAGCAGTGGCCCAGCAGCGCATCCAATCTGTCGGGCTATTCACAAGGCAGCAACAAGACGAGCAG
CACCGCTACGACGGCGACTTCGGCTGAGGACATCAATGTCACGCGCATCAAGATGCTGATCCTCAAAGCAGCCATGAACA
TCGGCTTCAGCCGGGACGCAACCGCGACTGATGGAAAGGCCGCCAGCAAGTCACTACAGGCATTCGTGAAGAGCCTGCCG
CCTGGATCATTTGGCAGCCTCCCCGCACACGCCTCTCTGCTGCAAAGCTACAAGAGCCTGGTTCTGGCAGACGCATTCCG
GGCGTCCAACAGCCTTCCCAGCCGGGGTCGACGTGTGGCTGCTTCGGATGCCGCCAAGAGCGTTGGTTGGATGATGCTCC
GGTCGAATCAATACGGCTTCCTGCGAGATCTGTTCAAGCTGGTCTTCAGCTTCCCGCTCGAGGAGGCCGAGGGCCGCAAG
ACGTCCAGCATCGTTGTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62