GenePrediction:GLEAN_3936 Details

Name: GLEAN_3936
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1785152..1790061 (+ strand)
Length: 4910
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1785152..1788669 (+ strand)
Length: 3518
Type: CDS
Source: GLEAN
Position: GCSC_113:1788978..1789085 (+ strand)
Length: 108
Type: CDS
Source: GLEAN
Position: GCSC_113:1789164..1790061 (+ strand)
Length: 898
>GLEAN_3936 class=GenePrediction position=GCSC_113:1785152..1790061 (+ strand)
ATGGACAGGCCGCCGAGGCTGCATCGCGCGGCACCGCCGTTGTGCCCGGTGACGGCGCTTGCCTTTTTCCAGAGGCGGCA
GCCGGGCATCGGCGAAGCAGAAGCAGCCGAGTCTGTGTTTCTGCTCGCCGCCGAGGACGGCTGGCTGTGTGTGTACGGTG
TGTACGGAGACGCTCGGTCGACCACGTCTCTCGGCCGGTTGCACGGCCGGCTGCCTGTCTTTTCCGAGCAGGCCATCCAG
GGGTGCTGCGTGGACGAGCACGACGAGGGCGACGTTCTCGTCTGGGGCGGCCGATCGGCAGCGCTGGTGCGCCGAGAGCA
GATCGAACGGCTGGGAGAGCAGCGAGCACAGAGCACAGAGTGTGTGGCAGCAACAGCCTGTCTGGAGGCCCGGGCGCCCG
ACTGGATCTACGACGGGCTGCTGCCACGACGGGCTGGCGGTCTGGGCGCGCTCGTCACTGCGCACAACGAGGTGGTGCCG
TTCCGCGTGGATGGCCAGAAAGGACTGGTGCTGGGCGCAGCCATCTCGCCGTCACGACCGGGACTCTACGCGGCCAAGCT
GGCATGGGGCGAGGAGGAGGAAGACGAACACAACAACGGTCTAGTCGTGGCAGCGGGTACAGCCTTTGGGGAGATTATCG
TGTGGACGTGTCGGCTGGCGGACAGCAGCAGCGACAACGACAATGACAACGACATCCAGGTCCTCGACGTCTTTTCCGGA
CATGAGGGCTCCATCTTTGGTGTGGCGATGCGGCCGGCCTTGGGACTTCTGGTCAGCTGCAGCGACGACCGCACCATCCG
GGCCTGGCCGCTGCGATTAAAGCAGCCGGGAGGCCGTGGTGGTAGCCGTGGTCGCGTGCTGACAGAGGCGCGCGAGACGG
GCTTCCTGACGAAAACAGCCGACGATGGTGATGCCACGACGACCCAGTCTCCTGAGGCTCTGGCCGTCGTCATGGCACAT
GCCTCACGCATCTGGCACGTGCGCTTTGGGCCGGCGACGTCCAGCCGCAGCAGCATCGGCCTCTTCTCCTTTGGCGAGGA
TGCCACGGCCCAGGAGTGGCGTCTGGTCCTAGACACGACCGCGTCCTCTAGCTGCTTTGAACATGTTCGCACGCTGTGTG
GTCACGCCGGCAAGAACATCTGGGCGGCCGCCGTGCTGCAGCCGCGCGGGACATCCGACCAGCCTCCTCTCGTGGCCACT
GGTGCTGCTGACGGGAAGATCTGTCTCTTTGCCGGCGTCGACTCACAAGAACTGGAACAGGAACAAGAACAAGGTCACGT
GCCGCCATCTCGGCCAGACGGTCCTCCCAAGACGCGGCGCGACGAGGTCTTCAACAACTACGCATTCCTGTCCGGCCACC
ACGTCCTCGCCGCCACCAGCCACGGCCGCCTTTTTCTGGGCAGCATCCGCATGGACGCCGTCGCCGCCTCGACCACCACC
TGGGCCGAGGTCGACGTTCCTCCGGCGGCTGTGGTCACGCTGCAAAAGTACAACGTCGTGCGGGCGCCGCGTGCCGACGC
CGGACCAGCCGTCCAGGGCCTCGCGCTCGTCGGCGGCGCTGGCGGACGGCTGTTTATGTATTCGCCGACATCGTCCGATA
GCGAAAGCGGTCGGCTGCAACCGCTGGACACAGCCGTGGCTGGCAAGGTGGAGGACATGTTCTTCTTGCCCGACGAGGAG
GAGGGCAACGGCGGCGACGACAGCACCGTGCGTCTGCAGGTCGTCATCGCCGTGCTGGCTCACGATGCCCTTCTTCTCGA
CCTGGCCGTGTCCGCTGTCGATGGCCGGGTGTTGAGCGAGCGCGCGCGACCGCTGCGACTGCCGTCTGGGTCTGATCACG
TGACTACCACAGCGGCCGGTCGATGTTGCGGGCACGTGATCCTGGGTTCGCGCAAGGGCCAGCTGCTGCTGTACCGACGA
GGTGGCGACGACGACGACTACGACGAGACGCCTTCGGTGGAGACACACACAGATACGCGCGACGCCATCCTGACCGTGGT
GCCGCTGCCGCCGCAACCGGGCCGGCCACGGGCGTCGTGTTCAGCGTTTGCAGCGACAGCCCGCGACGGCACATACCGGA
TCTATGCAATAGAGGAGAAGGAGCAGCACGGTGACGCAGCAGCTTCTGCTCTCTCTTTCCAGCTCCGTCATGAGACGTCG
CTTCCATTTGGCCCGATCATCCGCGACGCCTGGTTTGTGGACAGCAGCAGCAGCAGCAGTCCGGAGCTCGTGCTCTGCGG
CTTCCGCAGCTCGCGGTTCGTGGTGTGGAACGAGACGCGACAGCAGGAGCTGGCAGCGGTAGAGTGTGCAGGCACGCACC
GAACGTATGCGTACCGGCTGGGGGGAGGCGGGGAAGTGCGGCTGGCGTTTACACGGGGCGGCCGGCTGCACGTGTTTGCG
CAGACAGCGAGTCCGCTGGCGACGGTGCGACCAGGCGGCCACGGACGCGAGATCAAGGCGGTAGCGGCCAGTGCGAGCGG
CCAGTACGTGGCCACGGGCGGTGAGGATACGGTGGTGCGAGTGTGGGAGGGCAGGCGGATAGGAAATCAGCCAGACGGCC
ATCGAAACTGCCTCGCCGTCCTCAAGCGCCACAACACCGGGCTCCACGGGCTCGCCTGGCTCGGCGACGACTGTCTCGTC
AGCGCTGGTGGAGCCGAGGAGCTGTTCATGTGGCGCGTCAGCCGCATTGCCGACTCGGCCTACGACGGCCTCGCCGTGCT
CTGCGCGTCAGCTTATCCAGACCGCGTGGGCGATGACAAGACGCTGCGCGTGACGGCCGTGGACGCGAGCCTGGAGGCCG
ATGGGACTCTTCCGGCGAACACAAAGGCGAACATGCTCATCACCATGGCCCTCTCCAACTCGGTCCTCAAGACGTACCGC
TACTGTCCGGCCGATGACTGCTGGCAGCTGCTGGCCCGCGGCCGCTACACCGGCGCCTGTCCGACCCATGTACGCCATCT
GCGTCTGCGGCCACGTCAGGCCCTCGTCGTCCTGGCCGCCTTCACGGACGGCCACCTGTCGGTGTGGCATGCCGACACAG
CGTCAACCTCTAGCCAGCCAGCTTCGTATACCCTTCTGCGCACCACACAGGTTCACCGCTGTGCCGTCAAGAGCCTGGAC
CTGTGGCAGCCTCTGGTCGGTCCTGCACGGCTGGCTGCCGTTGTCGTCACAGGCGGCGACGACAACGCCCTTGCTGTGAC
GCCCCTCGACAGCGACGGTACCGACTACGCATTCCGCACGGCGAGCCGCGTGTCCAGCGCCCACGCAGCCGCTGTCACCG
GTCTCTGCATTCTCGGCGGCGCACAGCCGTCGGAAGCGGCCGTCCGGCTGACAGTCGTATCCTGCAGCAACGACCAGCGG
GTCAAGGCCTGGGCTGTGCACGTGGGGCCCTCGGTGCAGGTGCAGCTCCTCGACAGCCAGAGCAGCGCGGTGGCCGACGC
GGCCGACATGGAAATGGTGGACGGACAGGAAGCCGACGGCGCATCGGTCATGGTCGTAGGCATGGGCATGGAGACGTGGT
GTCTGGCAGGAGGGGAATAGCATGGAACGGGAGTTGTGAAAGGCATTAGCAGGCCATGCTCAAAAAGAAAAGTGCAGAAG
TGCAAAAATACAAAAATACAATTGATCGTGGCAGGGGTCGAACCTGCGATCCCATCCGATCAATACTGAATACTGTAAAG
GACATGCCCTAACCACTAGGCCACACGATCATTGGAGCGTGAATTTTTGGCGGGGTTCTAGCATATCAAGACCTGAGACC
TCTGATCTGCGGCCGCCGTACCGTTTGCGCCTGAAAAATATTCGGCGTACGAGACGAATGTTGCAGTGCCCACGTTACCC
AGCCCAATGCCCACCAGTCGACCATCATGAGCTTCACAGCAACACGTGCTCTTACGCGCCACGCCGGTGCCGGTCTGGCC
CGCTGCACAGCCGGGTGAGCACTCGTGTCTGCGGAGTGGCGAGCGAACGGAAGGGCGAATATGGATAGCATGACTGACAG
CAGCTGCAGCAGTCGATGGCCCACGCTCGTTCTCGGAGCAGTGGCAGCAGCAGCGACGCCCACGGCGTCCACGGCCAGTC
TGCCGACGTCGCCGCTCTGGCAGCCAACGGCCGTTTCGAGACGGGAGTTTGGGCACAGCATCGTGCGAGCGAAAAAGGCC
AGCGGTGGCGGCAAGAAGGGGGGCAAGGCGGACAAAAAGGACAAGGCCTCGCCGACGGCCGAGGACGATGATGGGGGCAA
CCACCCGCAGGCGGACGCGGCCGACCCGTTCAACTTTGCCGACGTGGAGTCGCGCTGGCAGCGCAGCGACGCCCACCACG
AGGACAAGTTCCGGGAGCTGCGACGGGCTCTGGGCAGCGGAGCGGCAGATGGCAGCGGTGCCGTAGACCTGGACGCGATC
GGGGCGACGCCGGTGACCATGGCCGCGTCGGGCAGCGAAGGCGCCACGACCACGACGCTGTCACAGCTCGCGCTGGTGAT
CCCGCGGGCCGGCGGCCGCTTTGTCGAGCTGCGCATGCACAGCGCCACCAGCCGCAAGGCCATCACGCGTGCCGTCCAGC
ACAGCCCACAGTTCCGCGGCCAGCAGCCCCAGCCAGACCCCGACGATGAGCTCGTCCTGCTCGTCCGCATGGGCGGCGTG
CATGAGGGCGCCACCGAGGCTGCCGCTGCGGCTGTCGAGCGCGCCCGCCGCGTGTCCGACCTGGCCAACGGCTGGCGCGC
GCAGATCCGCCGGGCCACCGCGCGGCGCCAAAAGACACATCAGACCTGGCGAAAGGATGGGTCCGTCCGGCCCGACGACC
TGCACCGCCTCGACCGCGACTTGCTCCGCGGCCAGGACAAACACCTGGCCCACATCGACACCGTCGAGAAAGAGGCCGTC
CGGCTGCTGGAGCGGACTGGGAGGCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62