GenePrediction:GLEAN_3937 Details

Name: GLEAN_3937
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1796357..1797313 (+ strand)
Length: 957
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1796357..1796627 (+ strand)
Length: 271
Type: CDS
Source: GLEAN
Position: GCSC_113:1796754..1797313 (+ strand)
Length: 560
>GLEAN_3937 class=GenePrediction position=GCSC_113:1796357..1797313 (+ strand)
ATGGATTCTATAGGTGATGAGCGGCTGCGGCCAATTAGCGGCCAGGGCGCTGGTCCTCATCACAGGAGCCCACAGGAGCC
CCATGCAGAATATGCAGGAAACGCAGGGAAAAAGTGGACCCACAGCAAAACGACTGGCCAGAGAGAATCGTACAGGCTAC
TAAGCGCCGAGGCGAAAAAGCAGCGAGCGGTTCGCTGTGGTGGGGAAGGGTCCCGGCGGCCAATCCGCGTCGAGACTAGC
CAAACAGCCAGCCAATGGGCGGGTGCTGAAGGTGAGAGTTAGCGGAGGTTCGTCGTATCGTCCTGATACGGAGGACGAAT
TGATTCTTCCGGCCACCCTCTTGCCCGATTAGTCATCTGCGGGAATGGTTCGTGACACATGGGCAAATCGTATATAGCTG
ACGGTGTGTGCGCCATTGCCGATCCAGGAGAATCAGGATCCACGGGGCAGTTCAGGACGCGCTGGCTCTACACCCCGTAC
GTAACTAACGGAACGACCAAAAGCACGCAGCAGGCCATCGCAGCGGCCGGGGAAAGGATGACAGAAGAAGACGGGCCCCA
GAACGGCACGCCGCGACGGACGGCACGAGGGACAATGGATCGTCTCGAAGCCGCGGCCGCGTTGTCGACAGACGGACATT
ATGTGTCGATTTCAGCCACGATCCAATCGCGGTCCAACGGCCCAACGGGACCAACTTGTCCGGCGAGCCAACGACATACG
ACGTACGACGTAGGCTGTCTCACGCCGTCTCACGCCGTGGTCGAGTGGGAGTTTTGCCGCAAACCCGGCACTTGCATGTT
TTGGCGTAGTTCTAGGGGCTCCTTCCAGTGGTCGGCCGAGCCCCCTAGCTGGCCGGTCATAGCGAGTCAGGCCATTGCTG
GAATGGGCGCCGGGCCTAGAACCGATCTGCGGCACAGCAGCGAGGCAGGAAACAGGAAAATGCGAGATGAAAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62