GenePrediction:GLEAN_3938 Details

Name: GLEAN_3938
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1798330..1803508 (+ strand)
Length: 5179
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1798330..1798362 (+ strand)
Length: 33
Type: CDS
Source: GLEAN
Position: GCSC_113:1798563..1803368 (+ strand)
Length: 4806
Type: CDS
Source: GLEAN
Position: GCSC_113:1803425..1803508 (+ strand)
Length: 84
>GLEAN_3938 class=GenePrediction position=GCSC_113:1798330..1803508 (+ strand)
ATGCCAACCGGACGCCAGCTAAGCATCAACGTTGTGTGGCTATTGCAGCTTCGTGTACGGCAGAAGCAGCAGTACAGCAT
TGTATCCAATCTCTCTCACGGGTAGACGGGAGCCTGCTACTGCCCTCATCATCGATTATTGTGTTCATGACTCCACAAAG
CGGCAACACCAGCACCAGCACCAGCAGCAGCAGCAGCAGCAACAGCCATTGCCACTATTTTGAGCTTTCGCAGGAGCCTC
TCTCTATACCGCGACCAGCTCTGCCTGTCGCTCCTCCCGTATCGTCTGCGCCTCCTCCGGTTCGCCAAGTTCCGTCGCCG
GCCGCCTCTGAGGCCAGCCGTGATGATTCAGAAGCTGCTACTCCGGTAGTTGGAACTGCTACTGGTGGTGGATCGGGAAC
TGGAACTGCTGTCGAGAACGCAACTGGTGGGCGTGGCGGCGCGGCCAGCCTAGAGGGCTATTGCAAGAGCAACAAGCAAG
GCGGCTTTAATCACAATAATCCCAATCCCAATCCCAATCACACACTCAAACGGCCGGATGCCCACCTTGTGATTGATCCC
ACCGTGTCTACCATATCCGACATCACGCCAATTTTGTCTCCCACGAAGCGACCTTGCCTCCGATCGTCATCCGGATCGAT
TCGCTTGGGGCGCAGCATATCGCAGCATTCAGCTTCAGCCAAGCAGCATCCCGAATTGCCGCCTGGCACCAACCTGGGCT
TCCCAGCAACCCCGGCCGACATGCTCGGCCGTCAAAACGGCGAATACGGACACCAGGTCGTGGCCCGCCAACTTATGCAG
CGAGCAAACGCCGTTGCCGACTCAGCAACGACGGCCGAGCTGGCCGCTTCCTGGCCTGTCTGTGACGACGATCCGGCCAC
GCCACGTTCCTCTCCGCTGCTTTCACCTCTCCTTCCTCTCCGCGACCTCAGCATTGTCGAGCTGCTCGACCAGGATGACC
GCCCGACCTTCATTGTCGATCTGACCGACAAGGCCAATTTCCGTCCCGGACCCCTGCAGGCCGTCTTCGCCAATACCGCC
CTCCGAGCAGAGCGGTCCGTATTCGGTCCGCTTGTCAACACTGCCTACGTCTCGACGACAGCCAGTCAGGCTACGCAGGC
CGAGGACTTTGTACGCTTCAAGGGCTGGCTATTGACTTTGGCCCGCAGCAATGGCCAGGCCCACGAAAGAAATCCGTCGG
TCTCGTCCACGACCTCTAACTTCTCCTTGCCCTTTTCACTCGCAGGCTTGCGGTGGACCTGCTCGACCCTTCGCCAGCGC
TACCGGGTAGTCCGCGGCTCGCATTGCAGCTGCGCCGACAGCGGCAGCTTTTCTGCAGACGCCAGGAACTGTATCTCTAA
CACGGCGGCTGTCCGGGTGCCGCCCCATTCCACATGGGTACCGGAAGGCACTTTGGCGTCGCCGACCGAAACAGCGGCCG
ATGGAGAGGATTACTTTGGCACCGCAAATATAACAACGGAGGCAAACTGCGATAACAATATAGTCCTTTTGGGAGAGGAC
AGGGCACACCTGTCATATGACTGGACCCAAATTGAATTGACCGGCGACACTCCGCAACACATCAGACTCGCCCGGTCGAT
AGATTGGGCAGCAACACCGCTTGGCCCTGTCGAGCTATGGCCTGCCGATCTCCGGACCATATCGAACATGGTTATGGGCA
GCCCGAACGCGGCCATCATGTACTGGGGGCCTGAGTACACGGCCATCTACAACGAGGCGTACGTGTCGCTGGCCGGCCGG
CACCACCCAGGGCTGATGGGATCGAAAACCCCGCTGTTATGGGGCCAGGACTGGGCCAACGTGCAGGCCACTTTTCGGAC
TGTGTGGAATTCGGGCAAGGCTATGATACGGTACGATGACCCGGTTTTTATGAACCGCAGCGGGTTCCTTGAGGAGACGT
TTCTGAATTGGTCTATTGTTCCTCTAATCGGCTCGGACGGGTCTGTGGTGGGCTTGCTGAACCCCGTGTTCGACAATACG
AAGCGTTGGGTTAACGAGCGTCGGATGCAAACGCTTAACGAGCTGGGCGAGATGACATCCAAGGCGCAGACGGTGCAGCG
ATTCTGGCATTCTGTAATGCAGGGTCTCGAGAAAAACCAATACGACATACCGTTTGTACTGGTGTATTCGGTAGCCAGCA
TCGGTGATGACGACGAGAGCGAGCAGGCGGCGATGCACTCTAGCGGCATAGGCGACTCGGCCAACCCAACAACACCACCT
CAGCTCATGTTGGAGGGATCGCTCGGCGTGACGCCAGGCCACCCGGCGGCCGTGGCCACGCTGGACCTGCATGTGAGCAG
CGATGGCTTTGCGCCGTACATGCGGCAGGCCATGGGGACGACAACGACGGGCTCGGCGACAGAGATGGCGACGCCAACAC
CGGTCGTGCTGTCAGCCGAAAAGGGGACGCTTCCGGCGGGGCTGCTGACCGGTCTTCAGGGCCAGCGCGGTTTTGGCGAC
GACTGTCACACAGTGGTGGTGTTCCCCGTGTACCATCCGACAGCGCTGACGGCCGGGACGGGCTGCGCAGCACTGGTAGC
CGGGTTTATCGTGATGGGGGCCAACCCACGGCGGCCATACAACCGGGAGTACCAACTGTTTGTGCACCTACTCGCGCGGC
AGCTGACGACATCATTTTCGTCGGCCGTGCTCTTTGAGGAGGAGACGCGGCGGGCGGAGCGGCTGGCACGACGGGCGGTC
CGTGACAAGCAAGAGCTGTCACAACAGCTGCGGTTGCGGACGCAGCAGGTGGTGGAAAGCGAGAACAAGTTTATGCGGAT
GGCGGAGTTCACGCCGGTGGGCATGTTCGTGACGGACGCACGCGGACGGATCACGTACTGTAATGACATGTGGTGGGAGA
TTTCGCAGTTTCGGCGGCTCACGCGGGGTGGCGACAAGACCAAGGGCGAGTCGGAGTCGTTTCCGGCGTTTCCGGGCGAC
GACGATGTGTCCGTGTGGTCGTCGTGGATGGAGAGCGTGGAGGTAGAGGACCGGGCGGGCCTGGAGGCAGTCTGGGAGCG
GATGGTGCTGGAGAAGGTGCAGGTGACGCACGAGTTCCGATTCCGGCAGAAGACGAGGCAGCCGATCAACACGCGGACGA
GCGAGAAGACGGAGATGACGACGTGGGTGCTGCTGCGGGCTTACCCGGAAAAGGACGAGAAGACGGGCGAGCTGAAGAGC
ATCTTCGGCTGCATCATGGACATCTCGCAGCAGAAGCTGGCGGAGGCGTTTGAGAGCCAGCGGCGACAGGAGGCGGTGGA
GCACAAGCGGCAGCAGGAGAACTTTATCGACATCACCAGCCACGAGATGCGCAACCCGCTGAGTGCGATCCTGCAGAGCG
TGGACGAGATCATGACGTCGGTAGCGGGGTTTCGGGCGGCTGTGGAAGCCGGTCAGGCCGGCGACGTGGCGGCACTGGAC
GACCTGCTGGAAGACGTGCTGGAGGCCATCAGCACGATTTCGCTGTGCGCCAACCACCAGAAGCGGATTGTGGATGATGT
GCTGACACTGTCGAAGCTGGACTCGAAGCTGCTGCTGGTGCGGCCGACGGCAGTACAGCCGGTGATGGTGGTGCGCACGA
CGTTGAAGATTTTTGAGGCCGAGTTCTACGCGCGCGACATCCGTTGCATACTGCGGGTGCAGCCGTCGTACGAGTCGCTG
GTCGGGGCCGGCGGCTGGGTCAAGCTGGACCCGTCGCGGCTGGCCCAGGTGATTATCAATCTGATCACGAACGCGGTGCG
CTCGACACAGGCGAGCGAGAATCGGACGATCATGATCAGCCTGGGGGCGTCACGCGAGGGCGAGTTGATGACCGAGCCGG
GCGTAGTCGACGTGGCCGATGACGTGGCCGAGGGCAAGCTGGTGTACATCCCGCGACGGCTGGACGATGCGGACGTGCAG
CCAGAAGGACCGGAATGGGGCACCGGCACAAAGCTGAACCTGCACATCGCCGTGGCCGACACAGGCAAGGATCTGAACAA
GGGCGAGCGCGATATTTTATTTCACTCCTGTGCCCACAAGCTGCCGAGGACCCACGTCGAGTACGGCGGCCCGGGTTTGG
GCCTCTTCATCAGCTGGAACCTGGCCGAGCTGCAGGGCGGCCAGATCGGCGTGGCCTCGCGCAAAGACCAAGGCAGTGTC
TTTGCCTTTTACGTCAAGTGCCGCATGGCTGACGAGTATCCGCCAAACGGTCAGTCGGCCGACGAAATCATGGGGATGCC
GGCTGCCGGAGAGCCGGAGAACCGTTTCGTGACCGTCTACTCGATCGGCCTAGAGAACGGCGGCTTAAGCATGGGCATGA
GCTTGGGGATGGCCAACAGCGACGACACAGAGGCGAGCCTGGCTATGGCCGGCCCGAGGGTCTTGCCGGCAGCCCTGCGC
CACTATCACTCTTCGCGTGCAGCCGTATCGACGGCGGTTGACTCGACGGCCGACAACAGTCCGACGACAACGCCGGCAAC
GCCGACAACGACGGCAACGACGGCAGCGCCGATGCCGCATATCGGTCTGCCGCTCTCGGACGACCTACCCTGTCTGGACG
TGTTGATCGTGGAGGACAATATTGTGAACCAGCGGGTGCTGCAGCGACAGCTGGATAAGTGCGGCAATCGCACTCACGTG
GCCAACCACGGCGGCGAGGCCCTGGAGGCTCTGCGCCGATCGCGTTTCTGGCGTGACGGTCCGGCGGCCGACGAGCAGCA
CGACATAGTTATGGACGCTGTCGTTGGCCAGTTTGCCGCCCTGGACGCATCCAAAGACAAAGACAAAAACGCCAGCAGTC
TCGGTGGTGATGGCGGTGGCGACAACGGCAACGACAGCAACGACAGTCGCCCAGCCACCAGCATCAACATCTCCATCGTC
CTCATGGATCTCGAGATGCCCGTGATGGACGGCTTGACGTGCGCCCGTGCCATTCGCGACCTCGAACGGTCCGGCACGCT
GGTGCGCCACGTCCCCATCATCGCCGTGACGGCATATGCACGGCCTGAGCAGATTGAGAACGCCAAGGCAGCCGGCATCG
TGAGTGCTCTCCTGCTGCTCTCAATCTGTTTCTGCCCACCAGACTAATCCCACAGGACGACGTGATCGCAAAACCGTTCC
GGCTGGCACAGCTGATGCCCAAGATACTAGAACTGGTCAGGAAGTACCAGACCATATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62