GenePrediction:GLEAN_393 Details

Name: GLEAN_393
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1497748..1499280 (+ strand)
Length: 1533
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1497748..1497753 (+ strand)
Length: 6
Type: CDS
Source: GLEAN
Position: GCSC_167:1499134..1499280 (+ strand)
Length: 147
>GLEAN_393 class=GenePrediction position=GCSC_167:1497748..1499280 (+ strand)
ATGCCGGTCCGTTGTAGGCTGAATCCTTTTATAGCGACAGGAGACGACAAGACATGGGGTGGAGAAGACGATGACATGAC
AAGCAGGATGATGATGGACGATATACTTGCATGACCAGGCGTTTGTTTAGCGTTTCGCGAGGTGCTTTCCTCTCTTTGCT
TTCCAAGCCGATTTGAACCCTTTTTGTATTTAGTTTGGTATACAGCACAGCACAGCGCAGTACCAAAGAGATACCCCATT
TGTGGCAGATGACACAGACGAATTGTGCAGCGCAAGTCCCAGCCTTGCCGAGATGTGACGACAACGCACGTAGTGATGCA
TTTTGTGCTTCTGATTTCCTTGCCAAAAGAGCTCCTTCCAACACCATTCCTTCTGCGAATGCTAAAAGCCAAAAATTGGA
TTTCCACCCGAGCGTAAATCAAACAAAACTATAATACAAGCAAGAGCAAAGCAGACTGTTATATTTGGAGCAGAATAGAG
AAAGAGTAGGCAGCAGAGGCCACTTGTCCGCGCACGTTAAGAAGCGAACCGCTTTGCCCGTTCCTCGGCCTTCTTCCGTT
CGACCGGGTCATCCAAGACGGCTCTCTTCTTTGGCTGGCCGCCGAAGCTGCCGTTTCCGTTTCCGTGTCCGCGAGCAGCG
CTGCCACCACGGCCACCACGCCCGCCCGCACGGCCATCGCGGCCGGCTCCACTGCGGCGATCCGGCATCACACGCTTGTT
GCCCCTTCCATTGTTGGTGGCGGCTGTGCCGTTGGCCGTCGTGGCCGCGCCGCCCGGTCCATCGATGCCGTCGGCGCCGC
GCTTGCGCGGGCGGTCCGGCAGAGCGGCATCGAGGCCCTTGACGGCGGCCTGATCGATGCCAAATCGAGCCGCACGCTCC
GTCTTCTTGGCCACGTCCGCGTCGTCGACGATGCCGAAGCGCTTGGCACGCGCGGCACGCCGCCGGGCCTCCTCGTCCGC
GTCGGTGGCGGCAAGGTGCTGCGACAGGCCGGGAACGACCTCGGACTCGGCTGCTGCAGGAGCAGAAACAGAGGCAGTCG
TATCTTCTGCATCGCCTGCATCGACTGCATCGGCGGCCTCACCGACTTCACCGACTTCACCGCCCACCTTGTCGTCGCTC
GCAACAACAGCAGCAGCCGGCACCGCTTCCTCGGCCGTGTCGACAACAGCCGCTGCCGCCGCTGTCGTCGGCTCTGATGC
TGTCGTCATCGTCGTCGTCTCGGCCTTGGCCTTGGCCTCAACAGCGGCAGCCGCAGCCGCTGGCACCTTGGCCGTCGGCT
GCTCGTCGTCCCAGTCGATCTCGTCTTCGGCTGCAGCTGCAGCGGTCGTCAGCAGATAAACGCAGGTTTCACCAAACAAA
CACTCTTGCCCCCAACTCGACAAAAGCTCGACGAAAACGAACCTTTGGCACCGCCCTTGCTCGCCGCATCGTTCTCCTGC
AGGCGCGCAATCAGGTCGGCCTTGTTGCCGTTCACCGTCAGGCCGCGCTCACTCAGCAGCTTCTTCAGCTCGGGCACCTT
GAGAGAGGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62