GenePrediction:GLEAN_3940 Details

Name: GLEAN_3940
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1823574..1825951 (+ strand)
Length: 2378
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1823574..1823791 (+ strand)
Length: 218
Type: CDS
Source: GLEAN
Position: GCSC_113:1823852..1825804 (+ strand)
Length: 1953
Type: CDS
Source: GLEAN
Position: GCSC_113:1825864..1825951 (+ strand)
Length: 88
>GLEAN_3940 class=GenePrediction position=GCSC_113:1823574..1825951 (+ strand)
ATGTCGACACTGGGCGACAGCGTGGGACAGGGCCCTGACTTGACAGCAGCGGCAACAGAACCAGCATTGGTACCGGCAAC
CGTGGCAGCTACAACACGTGCCCATCCCGAAGATGACGAGGAGCACCGGAGCAAGAGAACGAAGACAGAAGGTATCACGG
ACGTTGTTTCTGGCGAGAAGAAGCCGAGGGTGACGGGGATAGCTCCAATTAAGGAAGAGTAAGCGACCGTATGACGGAGG
GAGGGCTGAAGTGGCAGCTCAACTGCTTACAAACACAGGTACCTGATCGATGGTGGCGGGTCTGACGACCGGCGCGGGGG
CGATGTGTTTGACGACGACGAGGCCGAGGGGCGCGGTTCGAACGAGGCCGCACCGGTCTCTGCGGGCGGACGCAAGGGCA
AGAGAGGCAAGAACAAGGGCCAGAACAAGGAGCGTGATTTTGGCTGGTCCCGCGACGCCGTGCGGCTGTGCACATCAGTG
GCGAATTCGCCCGAGTTCTCGCCCAAGCCATGTCGGTCGGGCGAGCGGTGTCGCTGTCTGCACAGCGTGCGCGAGTACCT
GAGCACAGGCCGGCGCGGCGACGTGGACACGTTTGACGGCCGGTGTCCGGTGTTTGAGCTGTATGGCCGTTGTCCGTCCG
GTTGGCGGTGCCGGTTTGTGTCGAGCCACATGGAGGAGGTCGAGCATCCGGACGGCCGCAAGGAGCTGGTACTGGTGGAG
AAGGAGACGGCAGCTGGACGTCTGGCGGGCAGCGAGGACGACGACGCGCGGCCGGGCGTGGTCAACGTGGTAGCGGCCGA
GGAGAAGCACAACTTGATGCGCAAGCGGACGACGTTGGACAAGTCCGAGGCCTTTATCCAGTGGCTGGACCGGGAGACGA
GCATCATCAAGAAGATCTTCAAAGACCCGACCGGACGGAGCATTGAGGGCGAACAGAGCCTGCTGAAGCCGCCAGGTCCA
CGGGTCGACGACGCGGCCGAAGACGGAGCCAAGGACGAGCCGACGATTGACGACTATCGGGCGCAGTTTGTCGATCCACC
CTTTCTGCCGTCGGAGAAGCGACGGCTCTACTTTGGGCCGGAGACGCCGACGCTGGCGCCGCTGACGACGCAGGGCAACC
TGCCGTTCCGGCGGCTCTGCGTCGAGCTCGGCTGCGAGGCCACGTACTCGGAGATGGCCCTGGGCCTGGACCTGCTGACG
GGCAAGCCGTCGGAGTGGGCGCTGCTGAAGGCGCACGCGACCGAGGCGGTGCCACCGCGCGTCGACAGCGTCCGCAGTGC
CCAGACGGCCGGCTACGACAACGGCCGGGACCTGCGGTTCGGCGCCCAGATCGCGGCCAACCAGCCGTGGATGGCCATCA
AGGCGACCGAGGCCCTGTCTCGTTTGGTGCCGCATCTGCGTCTGGTCGATATGAACTGCGGCTGTCCGATCGAGATGCTC
TTCAAGACCGGCGGCGGCTCCGGCCTGCTCGAGGCCCACAACAAGCTCGAGCGCATGATCCGCGGCATGAACGCCGTCTC
GGGCGAGGTGCCCATCACGGCCAAGCTGCGTGTCGGCGTGCGTGATGGCTCGCCCACCGCCCACAAGGTCATCGAGCGGC
TGGCCTTTGGCGGTGTCGAGACGCGCGGCCGTCTCGGTGCCCCTGGCTGTGCTGCCATCACGCTGCACGGCCGCACGCGC
AACCAGCGGTACAAGAAGCCGGCCGACTGGCGCTACATTGCTGAATGCGCCGCTCTCGTGCGGTCTTACAACGAGTCACG
TGACAAGATCACTGACACCGTGCGTGAACCAGACGACCGCACGCTACCACCCGGCGGCCGCATTTTCTTTCTCGGCAACG
GCGACTGCTTTAGCCACGAGCAGTACCGCGCGCAGATCGACCAGGCTGACGTCGACACGGTCATGATCGGCCGTGGTGCC
CTCGTGAAGCCCTGGATCTTTGAGGAGATCGCCGCTGGCCAGTACCTCGACAAGTCCGCGTCCGAGCGGCTCGCCTACAT
CGAGCGCTTTGCCCGCTACGGCATGGAGGCTTGGGGCACCGACGAGCAGGGCCTCGGCACGACGCGCCGCTTCTTGCTCG
AACACCTCAGCTTCACGTCCCGCTACGTGCCGGTCGGGCTGCTCGAACACCTGCCGCCTAGCCTCAGCGATCGGCCGCCG
GCCTATCGCAGCCGCAACGAGCTGGAGGGCCTGCTGGCCAGCCGCAACTACAAGGACTGGATCAAGATCAGGTGCGTATG
GTGGTGTAGCGGCGCGAATGGTGACTTTCTAGATTTTCTGACACCCATAGCGAGATGTTCCTCGGACCCGCACATCCCGA
CTTCCGGTTCGTGCCCAAGCACAAGTCCAACAGTTACGAGGGCGAGGCTGAGGGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62