GenePrediction:GLEAN_3944 Details

Name: GLEAN_3944
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1850052..1852179 (+ strand)
Length: 2128
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1850052..1850278 (+ strand)
Length: 227
Type: CDS
Source: GLEAN
Position: GCSC_113:1850343..1852179 (+ strand)
Length: 1837
>GLEAN_3944 class=GenePrediction position=GCSC_113:1850052..1852179 (+ strand)
ATGCTGAGCGCAAGTCTTCTCGGCTTCGCCGCCCTGGCTGTGTCCCTGTGCAATGCCAACCCCATCGTGGTCGTTTCTCC
TCCGGTCTACGCGGAGCGCAGCAGCAGCAGCAACCTGGCTCTTCGAGAGGCCATGAACATGGCTGCCCGAGACGCTAGCC
TGCAGAAGCGTTCGGAGATGTCTGTCAACCTCGACCATGGCCTGGACGAAGTCACTTTAATCAAAGGGTAGGCTCTTTCT
GATGCGGTTTCCTCTTCTGCTCTCCTTTCTCTGCTGACACGTGACCGTTAGTTCTTGGAGTGAAACTGTCGATGGCATCA
ACAACACGGTCAGCGTAAAACTGGAATGCATCGAGTGCTCCACGACGGGTACTGTGTCTGCCAAGATCAAGGGCAGCATC
CTCAAGCCGAAGCTCCGACTAGACTTTTCGGGTGTCGCGGCTTTCATCGACCTGGGCGTCAAGGTGGCTGACAAGGCCAC
GTACACGTACACGATCTTTTCGTCGGAATCACCGGTGGGCATCTCGCTGCACGACGTCAGCCTCGGACTCGTCTTCTACG
TCGACCTCGTGCTCAGCCTGTCAGCCGAGGTCGAGCTGGAGGGTGGCTTCTTCGTGCAGGTGGGCAACGACTCGTACCTC
GAGGCAGACATCCGTAAGGGCACGATTGTCGACTCGCTCTTCACCGACACCACGGTCACGGCCATACCCATCACAGTTAG
CAGTGGCGATGCCACCTTCAAGGCCGACCTGCGGCTGCGAGTTGAAGCCGGCGCCAGTGTCGACATTCTGGGCGCCGGCC
TGGATGCCGAGCTCGGCATTTACGCCAACATCCTCGAGTTCATCGTCGAGGCCCAGAACACGCCCGCTTGCGATGTCATG
TTGTCTGAGACCTGGGACATCAACGCCGGCGCCTTTCTCGATGCTGACGTCGTCATCAACTACTCCTCTTTTGGCGCTGT
GCCCACCATCTCCACCACCCTCTATCAGGGCCCGACTGCCACTCAGTGTATCCGTACTACCAGCAGTGCGACCACGATTA
CGACTGCCTCTGCTTCTGCGTCTGCAAGTTCCAAATCGCATGTGCATACGAATGCGACTGCAACTGCAACTGCTGCCGTT
GTCGATGCCGTGCGTCTCGTCGTCGGCGCTCATGCCAACTCGGCGAACTCGTTCAGTGCCAACGTCAATGCTTCTGGCTC
CAGCATTGCCTTTCCGCCAGTCACGGCTTCTATGCTATCCGGTGTTGCTTTCCCATCTGTCACCGCTTCTTCTCCGGCCA
GCAGTGCCGTCTCGGTTGGCGGCCTTAAGCCTCTGTTTGCCAACACGACCGCATCTGTCGCTGCCTACTCGGGTTCTATG
GCTGCTGCTGCTGCCGCCACCACCGTCGCTCTGGGCTCCAACGGCACGACGCTGACGTCCACCATCTTTGCCACGTCGAC
GTACACCATCACCAGTTGTGCGGCCTCGGTCGTCAACTGTCCTGCTTCGCTCCAGAACAAGATCATTATCACCGATGTCG
TCACCAAGACTGTCGCCATCTGCCCCGAGGCCAGCACCACCATCATGCTGTCTTCGTCAAAGTCTGTACCGGTCGCCAAG
ACCACGACAGCTTCCGCTTCCACCAGCACCGTGACCGCCGTCACCGCCGTGTACGTTCTGGTGCCCCTCGAGACGCCCAT
CGTTGCCACCTTCACGGCCCCGACCTCTGTCGCGTCTGTGTCCATTTCGGTCATCGGCGCCGTCACAGAGAAGGAGACCG
CCACCGTCGTTCCCGTCCTCGCAACTGGGGGCGCCAATTACGGCAACGGCTCGAATGAAAAGGCCGTCCTCGCCGTGGGC
GATGTTGGGCCAACTGCTTTTGTCCTCCCAACGGGCAGCGCTGCCGTTTTTGCCAGTGCTGCAAGCTCTGCTGCGGTCAG
CATTGCTACGTCTAATTATGTTGCCTTCGCCGAAACGGCTTCCCTCGGCGTCACTGCCAGCGCCAAACCTGCCAGCACGG
CATCACCGACGACCACTTCGGCTCAATCGGCTGTGACAGCTGTTGTAACAGCTGCCGCTGGCCGTGTCATGAGTGGCAGC
TTTGCTGCAGTGGTTGGTGCTATGTTTGGCGCCCTGCTTCTGCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62