GenePrediction:GLEAN_3945 Details

Name: GLEAN_3945
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1852620..1853842 (+ strand)
Length: 1223
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1852620..1853649 (+ strand)
Length: 1030
Type: CDS
Source: GLEAN
Position: GCSC_113:1853709..1853842 (+ strand)
Length: 134
>GLEAN_3945 class=GenePrediction position=GCSC_113:1852620..1853842 (+ strand)
ATGGAAACGCTCAGCAACCTGGCAACACAGGCGGCCCAGGCGGTCAATCAAGTCTTGCCCACCGGCAGCGCCGAGGAGCC
CGTGTCTGGAGTTAGGGGGAACACTGATCAGGGCGAGCCTTTCGATGCTGGAAACAAGGAAAACTACGAAGTTTCCAATG
CCGGTGCCAGAACTACGGGAGAAACTGGCAGTTACTCATCGGGACGGGCTTCAGACCAAAAAGGCTCCGGAGACTTTTTG
AGTAACGAACCTCTTATTGGTAGCGGTGCTAGAGAAAATGGCAACTACTCGGGAGAACATACTTCAGACCAAACTGGCTC
TGGAGGATACCTAAGTAACGAGCCTCCTATCGGTGACGGTGCTGGAGAGACTGGCAACTACCCTGGAGGACGTACTTCAG
GCCACACTGGCTCTGGAGGACTATCTTCCAAGGAACCCCTCGTCGGAGCCACCGCCGGAGAGACTGGCAACTACTCTGGG
GCACGCGGTAGCGGCCAGACCGGGGAACCCCATACTGCCAGCACTGCGGGCGGTACTGACAGCTACTCCAGGGAACGTCC
CGTCACAAGCCACTCTGGCGCCAGAGGACTGTCTGGCAAAGAGCCCCTAGCTGCCGCTGCTGCCGGGGGCACTGGCAGTC
TGGCTGGAGGACGTTCTACGACCGGCTCTGGCCCTGGGAATCGTTCTAGCAAGGAACCCCTAGCGGCCGGCGCTGCTGGT
GAGCCCAGTGTGTCTGAGGGACGCCCTCCAAGCCACGCTGAAACGGGGGGACCGTCTACCCGCCGCACCCAGACAGAAGA
CCTCCCGACTGCTCCGTCGGGAGACCTCTCAACCACCCGCTCTGGCGGGTCTGCCGGCGGGCCTCCGGGTGTACCGTCTA
GCAGCGCCATCCCCGGCGGCCCCAATGACCCGTCCGTCCCGGACTCGCAGGAGAAGGGCACAGGCGAGAAATATGTTCGC
AGCTCCGGCCTGCAGGCCGATGGAGGCGATTTTGACGCGGCCAATCCGGGCGCTGGACGGGAAGCCGAGAGTACGTTCTT
GACAAATCATGACGAATCAATGACCCAAATTGCTAACACGTCCTACCAGGACTCCTTGAAGAGAAGGGCCTGCACCTGGG
GCCCGACAAGAAGGGCGACACCCCTGCCGGCGCAGCCGAGACCAACAAGGAGAGTAAGGGTGGCCTCGCGCAGAAGCTCA
AGGGCAAGTCTGGCCACGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62