GenePrediction:GLEAN_3946 Details

Name: GLEAN_3946
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1859341..1860847 (+ strand)
Length: 1507
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1859341..1859701 (+ strand)
Length: 361
Type: CDS
Source: GLEAN
Position: GCSC_113:1859766..1860847 (+ strand)
Length: 1082
>GLEAN_3946 class=GenePrediction position=GCSC_113:1859341..1860847 (+ strand)
ATGTCTGGGAGCGCTGGCTTCATGAACAATCTCGATCTGCCGTCTGGCACTCACCAGAAACACGCTTCTGCCCCCACTTC
TGCCTCTTCTCCCGACCGAGGCCTGCCCCTGGTGCTGAAAACTCAGGGCCACCACATCTACGTCCAAGATGGCCGCGAGA
TTCTCGATGCTTGTGGCGGTGCTGCTGTGACTTGTCTTGGCCATGGCAATCAAGAGGTCCTGAATGCCATGAACAGGCAG
GCGCAATCGTGCTCATACGTGCCATATGCCTTCTTTGATAACCAGAGCACGCGGAATCTAGAAGAGTGGTTGGTGCGCAC
GTCTAACGGCGTTATAGCCAAGGTCTATCTGGTGTCATCAGGTGTGTATGCTATGGTGTCAGCGACAAAGGTGAGCGACG
AGGAATGAAGGAACTGACAGAGCAGGGAGCGAGGCCATGGACGGAGCCATGAAGCTGGCCCGCGAGTTTTTTGTTTGGAC
GGGCCAGCCTCAGCGGGTCAACTTCATTGCCTGCAAGCCTTCATACCACGGCACTACACTGGGCGCTCTATCTCTCAGCG
GACACATATCGCGGCGTGCGCCCTTTCAACCCTTGCTGATGGGCGGCCTCGGGACCAGCCTCGGGACCAGCCTTGTGGAG
CACGTGACAGGGTGCAACACGTACCGGCAGCAGCAGGCCAGAGAAGCAGACGCTAGATTTGTTGCGCGCAAAGCAGCAGA
GCTGGAGGCAGCGTTTCAGCGACTGGGCCCGGCAACAGTCTGCGCCTTTGTGGTGGAGCCGGTGGTGGGTGCAGCTGCCG
GCTGCATGCCTGTGGCGCCGGGTTACCTGGCAGCGATGAAGGCAGTCTGCGCCAGACATGGGGCACTCCTGGTGCTGGAT
GAGGTGATGTGCGGCATGGGCCGCACGGGGACATTGCACGCGTGGCAGCACGAGATGGATGGCGGTGATGCCAGTCCGGA
CATCCAGACAGTGGGAAAGGGACTCGGTGGTGGGTTTCAGCCGTGTGCGGCCATTCTGGCCGGACGGCGTGTGGTCACGG
CGATGCACGAGGCCGACGGCGCGCTGTTCACGCACGGCCACACATACCAGAACCATCCGGTGGCGTCGGCGGCGGCGTTC
TGCGTGCAGACCATCATCCAGCGCGACAGCCTGCTGGCCAATGTGCGGGCACGAGGAGCGCAGCTGGGGGTGGCCCTGCA
TGCTCAGCTGGACGACCATCCGCACGTGGGCGACATCCGGGGCCGCGGGCTCTTCTGGGGCATCGAGCTCGTCCAGGACA
GAGGCAGCCGCGAGCCGTTCCCCATCGAAGAGCGTGTGGCCAAGCAGATCCACGACCTTGCCCTGACTTCCCGCTTCCAG
CTGCTGGTCTACTACGGCCAGGGCTGTGCTGGTGACAGCCGAGGGGACCACATCATGATCATGCCGGCTTACACGGTCAC
AGAGAAGCTGGTGACACTGATAGTGGATACTCTGACCAAGGTGATCCATGAGGTATTTAGCAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62