GenePrediction:GLEAN_3947 Details

Name: GLEAN_3947
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1862266..1864150 (+ strand)
Length: 1885
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1862266..1862337 (+ strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_113:1862423..1863082 (+ strand)
Length: 660
Type: CDS
Source: GLEAN
Position: GCSC_113:1863266..1864150 (+ strand)
Length: 885
>GLEAN_3947 class=GenePrediction position=GCSC_113:1862266..1864150 (+ strand)
ATGCACGAGATCATCACACTGCAGCTGGGCCGGCAAAGCAACTATGTGGCGACACATTTCTGGAACGCGCAGGTGAGGGA
GGGGTAGAGACGGAAGGAGAAAAAGAGAGGAAGCGAAGAACAGAAGAAAAGAAGAAAAAGCAGTTCTAACTCGACAGGAA
TCCTACTTTACGTACGGCAAGGACGAGCCGTCGCCGGTCGACCACGACATCCACTGGCGAGCAGGAATAGGCGCAGACAA
AACGGAGACGTATCTGCCGCGGACGGTGGTATATGATCGCAAGGGCGGGTTTGGGTCGCTGCGCAAGATCAACGCCCTGT
ACGAAGCGGCGCAGGAGGGCAACGACGGCGGCACCAGCAGCACCAGCGGCACGTGGGCAGGCCAGGCGGTGGTGCAGCGA
GAGACGCCAATCATACCGAGCGCGTACACGCAGAGTCTCGACACGGGCGGCGATGCAGCCGCGCTGACGCCGTCCATGGT
GCGATACTGGTCCGACTTTGGCCGTGTTTATTACCACCCACGCTCGCTCGTCGAGGTCGGCGATGAGCCCGAGGCTGCCG
ACGCCGAGCCTGACCTCAGCTGGGCTGCCGGCGATGCGCTCTTTGCCACGCTTGACCGCGAGCACGACCTGCTCGACCGC
GACCTCCGGCCCTTTCTCGAGGAGGCCGACCAGATGCAGGGCCTGCAGGTGTTGACCAGCATCGACGACGCCTGGGGCGG
CTTCGCGGCCCGCTATCTCGAGCGGCTGCGTGACGAGTACGGCAAGTCGACCGTGTGGCTGTGGGCGCTGCAAGAACCGG
TGGCACGGATGCCGAGGGTGAGTTTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTC
TTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTTTTTTCTACCTTTCTTC
TCTTCCCCTCCTTCTCCTACAACTTACACTAACCCCCCAGGCAAAACGTCTTGTCCGCCTCGCCAACAAGGCCCGTACGC
TCGCCTCGGCCGCCGGCCAGGCGTCACTGGTCGTGCCCATCGCCATGCCGTCGCTGCCGCTGCGCGGAGTCGAGTCCACA
CTGGACCCGCGCCTGACCTGGCACGTGTCCGCCTTGCTGGCTACGGCCATCGAGACGGCCACGCTGCCGTCGCGGCTGCG
TCGTGGCGGCGACTCGCTCGCCTACATGACAGAGCTGCTCAACGCCACCGGCCACCAGACCGTAGCCCACCTGCAGATGA
CCGTCGGCCAGTCCTGGCGGGCGATCCGGAAGGCGGCTGCAGCTGCGCATGCGCAGGACGTCGACATCGATGGGCCGGCC
GCCGCCCTGCGTCTGAACATCGACCTCGCACCTCAAGACGAGCCCCGGACGGGCGTCTACGGCCGGCCGGCCGGCAGGCC
AAAGAAGACGCGCATGTTTGGCCAGGCCGTCGTCTCGCGGGGCAGCAGCGACGACAAGAACGAAAAGGACGACGACGACG
ACGACAACAACAACAGCAACAACGACGACCGCACTCCCGACCGCGAGGACATGGCTCGGCGCCGTCTCGCCCTCCAGCCC
GTCAGCCAGAGATACCCAGTCGACCTCGGCTTCCCCCTGCTCGACAGCTTCCCCCACATCTACCAGCTCACAGCAGCACA
GCAGACGAGCATCCGGGTAACCACCGGCCTGGCCACCAACAGCACCGTCGCCGACAGCATCCAGGGCCTGCGCAGCGTCG
TCGTGGCACCGTGGGCCGTCAGCCTGGAAGACCGCGAAGACCTCGGCAACGAGCTCGCCGGCATGGCTGACGCCTACCAC
GAAGGATGGTCCAGCGGCAGCGACGAGGCCGACGATGACGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62