GenePrediction:GLEAN_3949 Details

Name: GLEAN_3949
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1869358..1871209 (+ strand)
Length: 1852
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1869358..1869477 (+ strand)
Length: 120
Type: CDS
Source: GLEAN
Position: GCSC_113:1869974..1871058 (+ strand)
Length: 1085
Type: CDS
Source: GLEAN
Position: GCSC_113:1871125..1871209 (+ strand)
Length: 85
>GLEAN_3949 class=GenePrediction position=GCSC_113:1869358..1871209 (+ strand)
ATGTCCAACAACGTAGTTGGAGGCGTGTACCAGAGTATCATCGAGGAGGTGATGACCACGTCGCATGTAGACTTCGAGGA
AAACGGCGTGGAGGAGAGCGTTTTGGAAGACCTATGCAAGGTAAGGAGCAATATGTTTCTTCTCTCCTCTTTTTTGGCCT
CGGCCTTCCTCCTGTGCCTGTTTTGGAGGAAGTCCTCTCAGTCTCTTTTCATGTGGATTTCAAGTCCATTCACATGCCCA
CCAGATTCTTCAAACCCTGTTACAAGGTCATAAGAATCTGGGTGTTGGCACCGTTTTGGGGGGCATCCGCGTCGTGGCCA
GCACTTCTTTCAAGTGAGGAAAAATGTCGGGCTTGGTTGCCTGGAAATCGGGTGGGTGGCGTGGCCTATTTGGGGCGCCT
ATTTAAATTTACCACGACTGCCCCGCCTGGTTGCGTCGCACTAATTTCCCTCACTTGACCACATTTCATTGGCGGAGACT
ATAGACTACTACGGATCACGTGCTTTCGGGATCTGGCCGAGATGAGCCAGATGGCAGACGGACGATGCCACTCTACTCTG
CCATTCAGCCAATAACGTTGTTTTGAGCTCCCAAATTGACCTCCCGTTTCTCACAGGGCTGGAAGAACAAGCTGTCCCAG
TTCAATGTGGCCCAGTTTCCATGGGATCCCAAGCCAGACCAAGAACAGCTTCACAATGTCGGCCAAGGATCAGCACCAAC
CAACTCGAACGGTCCTTTGGGAGTCGTGCCTTCGCCGACGACGACCCATCATATGGACACTAGCTTCTCGCAAACCATAA
CAAGCCCCGTGTCTAGCTCTCAGGGACTTTCGATGTCCCTGCCCATGCCGTCTTTCGAACCCGCCGTCGCTAAGGCAGAG
GACATGGATCACGGCATCAAGATGGAGCCGGAAATGCACCATGGTTCCGGTCTCTCCGGCGTGCCACCGGCAGCACATGG
ACAAGGTCCTGCCATGCAGAATTACACCACACCACAGCATGGCGGAGGCAACGCAGCAGCACGGGCCGTACAGCAGCTGC
AAAACACGTTTGGACAGCGCGCAGCCGCGTCAATCAACGCGATCCATTCGGGCATGAGCCAGAGCAACCCGCAGCAGCAG
ATGGGTCAGCGGCTGGGGCCAAACGGACAGGTGCAGCAGCAGCCACTAAATGCGCAGCAATACCGTGCTCAGCTGGCCGC
CCATCAGGCAGCGGCACAGATGAACGGCGCAAACGGCATCTCCAGGTCGCAGATGGATGGCGCAGATGACGGAGACAATG
GCGGCGAGGCCCCATTTTTTGAAGGCGTGCTCATGCAACAGCGGGTCGCCGGCCAACCCCCGGTCGAGCTTGGTCGCATA
GAGATTGACAACATGCTCCACGAACAGATGGCCCTGCGAGCGAAGCAGATGGAAGGTGGCGGCCTGATGCTTCCGCTACG
GCAGGCAGCCAAGCAGAAGCGCAGTGCGAAAGCCTCGGCTGCCGCTCCAAGCCAGCGGAGCCGTGTGGCTGGCACGATAG
CGCAAACAGATGGTGCCGACGACGACGACGATGAAGCCAAGGTCGTTGATGACGAGGACGCCATCAACTCGGACCTCGAT
GACCCTGATGAAGACAGAGAAGACGACGACGATGAAGATGATGTCATGGGGCCTATCATGCTATGTGTATACGACAAAGT
TCAAAGGGTCAAGAACAAGTGGTAAGTGAATTTTCGAGCAGCCCCTGTGCATCTTTCCGTGCTGACTCTTCTTTTTCTCT
TCTACAGGAAGTGTACTCTCAAGGATGGAGTACTCACTGTTAATGGCAAGGAGTACGTATTTCATAAGGCAACAGGCGAG
TACGAATGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62