GenePrediction:GLEAN_3951 Details

Name: GLEAN_3951
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1878704..1880183 (+ strand)
Length: 1480
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1878704..1878892 (+ strand)
Length: 189
Type: CDS
Source: GLEAN
Position: GCSC_113:1879063..1879119 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_113:1879212..1879588 (+ strand)
Length: 377
Type: CDS
Source: GLEAN
Position: GCSC_113:1879898..1880183 (+ strand)
Length: 286
>GLEAN_3951 class=GenePrediction position=GCSC_113:1878704..1880183 (+ strand)
ATGTCATCGACAACGTCAACTGCCGGATTTTCCGCCTCGTACATTGCATACAATGAAGGTCATACCCTGGCTAGAATCAG
CTATGCAATGATACCCATTTCTGGTATCATTACTGCCGCCAGATTCTGGTCAAGGAAGCGGAAGCACATATCATACGGCT
GGGACGATTGGTTGACTCTGATATCTCTGGTAAGCTATGTTTGCTGTCCACTCACGACCTGGTCAGACGCTAATCTGCCT
TTTCGTGAAGTTTCTTCTGTGGTTCAATTTGGGTATTGCAATTACCGGTAGGCTTGCCCGATTACTATACTCTTTGTAAA
ATCTCTCCCCCCAATATTATAACCCAACTGACAACATAGCCGTCTACTGGGGCGGCGTTGGAAGAAACATGGCAGTGGTT
TTGGCAGAAGACAAAAGTATGTACAAGCATGCCTTGCTAGTAAGTTGCCCTGTTACTTTACCTCATTGCCACTTCTGAGA
CAATAATTCTGATTGATCGAATTATCAGTGTTTGTTCATGACCGAAATCGTGTACGGGACGTGTCTTTGTACGATCAAAG
CCGCCATTTTGCTCATGTATCGCCGCATCTTCCCGACTCGGCTTATGGAAATCGGAGGATGGTGCATTGGCGCTATCACG
ATAGCTTTCTGGCTTGCTGGTATTCTTGTCAGCGTTTTTCAGTGCAGGCCGATCCGCAAGACCTGGGACCCGTTCATGGA
AGGAGGAACCTGCCTGAACAAGTATCAGTTCTTCCTGGGAAGCTCAATCTCTAACATTATCACGGATGCTTTCATGCTCA
TTCTGCCAGTCCTCGAGGTTCTAAGGCTGCAGATTCGCTTCGGACAAAAGATTGCTATCGCAGGAATCTTTCTGCTAGGC
AGTTTGTACGCTTTCATGTCCTTTGCCCTTTCACACCGTCGTTGGGCCTACCGCATACTAACGGGAACAAGCGTTGTGGT
TTGCAGCTGCATTCGACTGAAATCGATTATTGATCTACTTCATAGAGGAGACAATTTTACTAGTAAGCACTGCCTATACT
TGGCGATCACTAGCTGAAACGCGTCTGACCTCGGCTTAGGATTAATCACGCCCTCCTGGAACTGGACAGTGATCGAGCTG
ACGATCGGTTTACTCTGCGCCTGCTTACCTACGATGCAACCAGTGGTACATTTACTGTTCGGCCGCCTTTTCAGCACACC
GTCCAATAAATCCGGCGATACGAGCGAGCTTGTAACAATTGGAGGCGGGACGAACTTAAAGCACAGTGCGAAGCCTAAGG
TAAGGGACTCATTCATGCGTCTGCATGGCAACGACTCTACAGAGGAACCGGTCTTGTGGCCTAGTACCTATGCGGGAGAC
TTGGCCACGACCATTGAGGGAGCACAGGACGACAGCTCAAGCACGCAAGCTGCCATCCCTCTGGACACAATCAAGGTGCA
GAAAGCCATCACCTGGGTGGAATCGAAACCGAACGTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62