GenePrediction:GLEAN_3954 Details

Name: GLEAN_3954
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1894844..1897783 (+ strand)
Length: 2940
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1894844..1895789 (+ strand)
Length: 946
Type: CDS
Source: GLEAN
Position: GCSC_113:1895861..1895972 (+ strand)
Length: 112
Type: CDS
Source: GLEAN
Position: GCSC_113:1896336..1896480 (+ strand)
Length: 145
Type: CDS
Source: GLEAN
Position: GCSC_113:1897328..1897783 (+ strand)
Length: 456
>GLEAN_3954 class=GenePrediction position=GCSC_113:1894844..1897783 (+ strand)
ATGAAGCGACACGAGAGCCTGATTGACGTGGAAGCGAATGCCTGCAACATCGAAGAGGCCCAGAAAATGCGCCAAAGCGT
CCGAGAATGGAAAGAAGAGAGTGACATTCGGCTGGTGGCGATGGAAAAAGAACGGACTGCAAGCCACTTTGAGTCCGTTC
TTTCATGGCTTAGGGTGGACGAGTCTGACCAGCTGGCCATAATCGAGTCTATCTCAGCAGAGGCCGAAAAGTACCCAGGC
ACCTCCTCGTGGATCATCGAGAACGCCAAGGTAAAGGCATGGCTTCGGCCCTCTCTTGACCCTCCACTACTTTGGATTAA
AGGAAGCCCCGGCACCGGAAAGAGTGTTCTGGCCGCACAACTTCTCAACTTTCTGAGAACTGCGAGAATGCTTACTGTAT
GCCATTTTTGCACATACTCGTATGTCTCGTCCATCTCTTACGAGCATATTCTGCGCTCTCTACTTGTTCAAATCCTCCGT
AGAAACGAAGAGCTTTCGGCCTATGTCTACAATGATTATTTCCTCGACAAGAAAATTCCGACCTTACGGGTGCTCGAGCA
GCTGTTACAGACATGCGTTGAAAATCTGTCTACTATGCCGGACAAGTTCGAGCGTGTCTGGATTGTTCTAGACGGGCTTG
ATGAGTGTGAGGCAAGTACGCAGCTGCGCATCATCAGCACAATGAGACATATCACGGCGAAAGCAAGTTCCAGTAACAAA
GTCGCATGCAAAGTTCTGGTGTCAAGCCGAATGTCAGAGACCATCTCAGATCGACTTCGCAAATCAGATTTGGTTTCTCT
AGCCGGTGAAAAGGACTCCCTTGACAGATCGATTCGCCAATATTCCAACTTTCGGCTTCAAACACTACACAGAAAACTAG
AGCAACTGTACGTTGCATCAACAGATGTCAATGATATTGTAGAGGCGATTGTTAGAAAGGCCGATGGTAAGACGTCTAGT
TTTATAAGTTATAGCTACCACACAGGACGTCTAACAATGGGTACTAATTAATCTTAGGAATGTTCCTATACGCCAGGCTT
GTCCTGGATTTTATTTCTTCCAATATATTTTACGAAATAAAAGAGATCAAACAGTCCGTAAATCAGCTGCCGGAGCAGCT
TGCCAGCCTGTATGTTTTTTATTACAAAGCAGCGGGCACATACTAACAGTGACAACCAAAGATACCGTGAGATTTCTACT
CGAATGCTCGCCAATTTAGACAAGCTGTCAGTTGAACGCCTGAAGTGCATGCTGGGCTGGATCGCCTTCTCCAAACGCCC
TCTCAAAAGGCTCGAGTTCATGTCAGCTGTAACCTTCAGCTCTGGCCGACAAGATGCTCTCCATCTCGTTCCTCAGTTTG
TACTGGATGTTATATCTCCACTAGTTGAGGAGAGGCACGATTCAACTCTTGGTTTCATTCACGTCTCTGTGAAAGAGTGC
GTAGTGCCGTACCAAACCCTTGTATATGAAGAAAATCTAACTTCTTACACAGCTTTCTACAAGACCGCAAAAGCCCTTTG
CTGTTGAAAGAGTCAGACTCTGTCACCGCACATGGAATTGCTGCAACATCATGCCTCCTGTCCGGGATCAATGTCTTCGG
TCCCAAAGATGACGCGGACAAACGTCGTCTTCGCGTGGTCAAAGGATTACACGCTTTTCATATATATGCGACAGACTACT
GGACCGAATATCTCCTAGCTAATGCGGCTTCACTGGACAAGGAACACGTTTCGTCAATGCCAGCATCAACGACTTTGATA
GAGCTTGCAAACAACTTGGCCACAAGACTTGATCAGCTATGCCATATCACAGACTGTAGAGAAATGGTGATGAAAGATAA
ACTATTGCTCGATACCAGGTTGTCACGCCTTGAGCAACACCCTTCGCTTCAAAAATGTGTGGCAGAGAACATTCTGGCAA
GGTCCCCCGAGAGACTTTTGTTAGAGCTTTCGGGTAAACTTACAAACGTCCGGGCCTTTTGCATGATTTACAACTAATTT
TCGAGCAGAAAACCATGAGATGAAGCCACCTGCAAATGGCCTCTCCCTTCTGTTAGCATTATACCGGGAAACACTCAAAG
ATCTATTGGCTCAGGATGACTTTCCCGGTATCTCAGCTTCAGAATTTGAATACTTCAAGAGTCAGTTTCGAACATCAGCT
TTTACGTGCCGAATTACTTCTTGCCCAAGAGCGACTGTTGGGTTTGAATCAGCAAAGCTTTGCACGGAGCATGAGATGTC
ACATATCCGCAAGTTCCCTTGCACATATAGCAGCTGCGAATACCCACCGTTTCCGTCAAGAGCAGCTATGCAGGCACATT
TTTCGCGACTTCATGCTCGCCATACACCCAGGCCATCGATTCGAAACACAGAGTCTAGAGCTAGTCTACATGATACTGAG
GACGACGTGGATAGTGGAAGGTTTTCTCACAAAGACCAAAGCCAAGAATTGCAGCAGAAAAATCTTGAGAACACCCCACT
AAAGAAACAGGAGCTTGTACTGCTTGACGACTTCTTTAACGAACCTATGGAGGAAGTTGATGCATCGCTGAACAGAATGA
TCGGACAGCAGAAGCTTCATCTGTATCAGCTGCTCCACCCGAACCTGCTAAATACGCGTATTGTGGATCTCGACGTGCCG
CTGCTGCCACAGCTTGTACCAGAGCTCGAAATACTGAAACAACATCTTAGGCCAGAGCTCGTAAATCTGTTGCAACAACA
GCTTGAGGAGCTTTCGCAGTTCTCAGATTATGCACAGCAGCAGAGACTAAGTGCACAGGAGTCGGCGCAGACCACTGCAC
TGCAGTTTGGTATAAATCTAGCGAATGCGATCGGCTACTTACATAGGAAACTTCAGCAAAAATCTGAATATCACGAGCAG
GAGATTGGACATTGGCGACAGAATTTGCAACAGGTTTTGCCGTACCTAACCGGAGTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62