GenePrediction:GLEAN_3955 Details

Name: GLEAN_3955
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1899889..1905210 (+ strand)
Length: 5322
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1899889..1903071 (+ strand)
Length: 3183
Type: CDS
Source: GLEAN
Position: GCSC_113:1903135..1905210 (+ strand)
Length: 2076
>GLEAN_3955 class=GenePrediction position=GCSC_113:1899889..1905210 (+ strand)
ATGCCGGCTAAGCGAAAGAGAAACATTATTTTCGATTTTGATCCGAACAAGTCGGACTCGGAAGACGAGAACTTTGAGCC
TGGTGAGGACCGAGGAGATCGCCCGCGCCGCTCGAAGAAGAAACAGCGCCCAGTCAAAGCATCAAAGTCTGGCAGCCGTC
GGCGAAACGACTACGCGGGATCGGACATTGACGAGGACGGTGACGAAGTTTCGGACGACAGCCTACAGGAGTCCTTTGCT
GAAGACGACGAGGACGACGAGGACGACGAGCCTGTTACGAGTGCCACCGGCCGCCGGACAAGAAAGGCCGCCATAAAGCA
CCAGAGCTACAAGGAGAGCAGTGAGGACTCGAACGAGGAGCCGACAGAAAGCGACAGCGGAGACTCTGACGCCTCGAAAG
ACGTGAAGCCCAAGCCGAAAAAGGCTGAAAGCGTTGGCCCGCAGACGCCACGGAAGTCACGGATAATTACACTGAAGATG
AATTCGAAAAGCCTACGCGATCGCGCGGCTGCTGCGACAAGCACAATCACGACCCGACGCACACGGGCAACCACGGAAGA
GGCAGACGAGCTGATCGAGCTGTCAACGTCGGGTCGCCATGCTCGGCCCGCAAGGACAGTGGCGAGCGTGAGCCCGGAAA
GGCGCACTGCTGCCGGACGACCACGCCGAGCCTCCAAAGGGACGAAGAAACCGCCGGTGCCTGCTATTGAAGAAGCTACT
CAAGAAAGCAGTGAGCCTGGCCTTGGGGGTGATGAAGGTAGAACAGAGATCTTCGCAGGTGGCGATGGCGTTGACGAGAG
TACTTTGCGTGATTCAGTCTCACTGCACAGCCGCCTGCAGAGCTTGGACGCGACTTCTGGCGCGGCGCGTATTACCATCA
GCGAGTTGGCCGAGAGTAAAATTGAGGTTGGGGACAGTGCTGAAGGCGACGATGACAACACCGTTGATAAAGAAGCTCAC
GAGGACATACCGGAAGACGTTGCCATGGCTGATGATGTCGCTGGAGAGGAGGATGACGAAGACGACATACCTGTTGGCAG
ACGCACGCGACAAACTCGCTCAGCGGCTGCTGCTGCTCCCGTCGATGACGTTGGTGCTCCTGCAGGAGAGGAGGAGCTGG
CAGACGATATCAAAGCTGACGCCGATGCTGATGCTGATGCTGATGCCGATGCCGATGCCGATGTCGATGCTGATGTCGAT
GTCAGCAACGCTGTTGGACGACGACTGACTCGCGGATCGCGTCTCCGCAAAGCCAAATCTTTGAAGGAGCCTAGTAGCGA
CTTCGAGCCCGTGGATGACGAAGAGTCTGGGGATGGAGCAGCCTTTGACTCCGACGCATCCAAGCACAACAGCGGCCACA
ACGGAGACGACGATTCCAGCCAAAACTCGCGAGGCCGACGACGGTCAACGCGGATCAAGTCTGGCACGAAGCGGACTCGC
GGTGCGGTCACGGACGACGAAGACGACGTCGACAGGGATGAAGTGGCCATGGAAGCAGAGGAGCTTCGTGCGAGCTCCCA
TTCGCGGCCGCGGCGGCGAAGGCAGTCCCCGTCGATCGTTTATGAAGCGACATCGCGTCGGCGGACCACCAAGGTGGTCG
ACTACAGCATCAAGCCGCTCGACCAGTACCCCATTGAGCAAGAAGAGGAAGACGAGCCGACACAGACACCGGCACGCAGG
CGTAATGGCCGTGGTGGAGGTGCCGCCTCGTTGTGGCAGCGCAACCTGCTCTCGACGTTCGGTCCTTTTGGCGGCGGTGG
TGGCGACGGTTCGCTCATCGGCGGTCCCTGGGGCACCGGGGCAGCGGGAGGTGTGGATTCGGACAGCAGCGACGACGAGA
TGATAACGCGTACTGGCCTGTCCGGCGCCATTGGCGGCAATGTCGGGATGACACCGACGACAGGTACGGCGCCATCGGGC
TTCGCGGCTCCCCTTAATCTCGAGTCTATCACGGGCGTCTCGGCAAACACCAACGTCGGCAAGGTTAAGAACCACAAGGC
GCTTGCCGATGCGGATCCACTGGGCGTTGACATGAACGTGGACTTTAGCAAGGTGGGTGGCCTTCAGGGCCACATCAATC
AGCTGAAGGAGATGGTCACATTGCCGCTGCTGTACCCGGAGCTCTTTCTGCGCTTCAAGGTTACGCCGCCTCGTGGCGTC
CTGTTCCACGGTCCTCCGGGCACAGGGAAGACGCTTCTTGCACGTGCGCTGGCCAACTCGGTGGGCGTTGGCGGCCGCAA
GATCACGTTTTACATGCGCAAGGGAGCGGACGCTCTGAGCAAGTGGGTGGGTGAGGCCGAGAAGCAGCTCCGACTGCTAT
TTGAAGAGGCTCGACGAACGCAGCCAAGCATCATCTTCTTCGACGAGATCGACGGCCTGGCACCGGTGCGGTCCAGCAAG
CAGGAGCAGATCCACGCGTCCATCGTGTCGACGCTTCTGGCCCTGATGGACGGTATGGACGGTCGTGGCCAGGTGATCGT
GATCGGGGCCACCAACCGGCCAGACAACATCGACCCGGCACTGCGTCGGCCAGGCCGCTTTGACCGCGAATTTTACTTTC
CCCTCCCCGACCTGGAAGGCCGGCGATCGATCATCGACATCCACACCAAAGACTGGGGCTTGACGGACGACTTCAAGGGC
ATGCTGGCTGAGAACTCCAAGGGCTACGGCGGAGCCGATCTGCGAGCACTTTGCACCGAAGCGGCACTAAACGCGATCCA
GCGGACATACCCACAGATCTACTCGGCGCAGGACAAGCTGATTGTCAACCCAGAGCGGATCTTTATCCACGCAACGGACT
TTACGCTCTCGATGAGCCGGATGATCCCGTCGTCTGAACGGTCGGCCACGCCGGCATGGGCGCCCCTGCCCAAGCCTGTG
GCGCCTCTTCTCAGCGACCAGCTCTCGACGATCCAGGCGCTGTTGGACGACATCATGCCGAGGCGGAAGAAGACGACGGC
GTTGGAGGAGGCCATGTTCGAGCCGCTGCAGGACGCCGACCACGGGTTCGGGCGCGAGAACATGATTCAGGCATTTGAGC
GGTCGCGCACCTTTCGGCCTCGGCTCATGCTCACCGGCATGGCTGGCATGGGCCAAGGATATCTGGCGGCGGCGATCCTG
CATAATTTCGAAGGCGTCCACATCCAGAGCTTTGACCTGCCGGTTCTACTGGGCGACGGACGAGTAAGTGGAACCTGATG
ACTATCAACTGGACGAGAAACTTGGTGCTGACAGTTGCCTTTGTAGCCGCTGGAACAGGTGATCGTGGGGCTGTTTGTGG
AAGTCAAGCGCCACAAGCCGGCTGTGATTTATATTCCCAACATTGATGTCTGGCACAACAGCATCACGGAGTCGGCGTAT
GTGACGTTTACGACGATGCTCAAATCCATACCGCCCAACGACCCCGTTCTCGTCCTGGCGACATGCGAGTGTGAAGAGGC
AGAAATTCCACGCTCTGTCCTGCGCGACCTATTTGGCTACTCGTCGAAGAACCGGTTCCGTCTGGAGAAGCCGACTCGGG
AGAGCCGGCGCAACTACTTTATCAGCTTCGTGGAACACGCATCGCGAAACCCGAGCGAGTTCCCGGACCCGGCCAACCGG
AAAAAGAGAGTGCTAGAAGAGCTACCGATTGCGCCACCACCTCCACCAAAAGTCAAGACGAAGGAGGAGATTCGCGAAGA
GCTGCGCAGGGACCACCTGCTGCTGAACCTGCTCAAGGTGCAGCTGCAGCCGATCATGGACCAGATCAAGAAGTACAAGA
AGTTCCGGCAGCCTGTCATCCCGGAAAGCCAGATCTCGTACCTGTGGCAGGAGGCCGACCCCAGCTATGTTCAGCCGGAT
ATTGCCAGCGAGCAGCCGCGACCGTTTGTGATTACGAGGAACAAAGAGGGCGCAGTGGGCCTCTGGGAAAGGGAAACCAA
CAAGTTTTACTACAACCTGGACCTGTCGACGATCGAGGAGCGGCTGTCCAACGGATTCTACGCACGGCCCAAGGACTTTT
ACGAGGATGTCGTGTCTCTGGCAAAGGATGCCAGGAACATTGGCGACAAGGAGCGGCTGCTCAAAGCAAACGAGCTGGTG
ACCAACGTGGAGGTGGACGTTGCCGAGGCCGAAGCCCGACTGTCGCAGGTCAATTGGGAGGAGCTCTACCAGCGACAGCT
GAAGCGGGCGCGGGATGCTGAAGCGAAGGCGGCGAAGCGGAAGGCCGGGCTGGCGATAGTCGGTGCCGTGGGTGTTGGAG
GAGGCACGGACGAGGCAGCGATCCGGCCCATCGGCTCAGACATTGTGCCGGCGGCAGGAGGCGACGATGAGCTGGGCCAA
CATGTTCAGGCGCAACAACAGGCGCGGTTCCAGCTCAAGCCAGACATTGGGTTTGAGTCGTTGCCGTCGACGCCGAACGG
GAATTCACACCTCGGAAGCAATGGGACGTCGGTGCCTTCTGGGCGGCTGACAAACGGAGACGAAGACGTGTCGATGACGG
GAGCAGACTTGGACGACAGCCCACAACAGGATGCGCCCAGCACACCGTTGGGACAGCAGTGGGCCAGATCGACGGGTCCG
CCGGCAATGCTGGATGCTTCGACACGGGCGACGGCTGGCAACACGCAGGTATCGCAGATGTCGGTGCTGACGGGCATGCC
GTCGGGTATGTCACCGTCTGCAATGCTGAACGAAGCGTCGACGACCAAGTCGTCTGGGCCGTGGAGCACGCAAGCCACCA
ACGGAACGCACGGGACGGGAGCCAGCAGCGGTGGAGGAGGGCATGGATCTGTGGGATTGGGAGTGGGAGTGGCTGTCGGT
GCCGACAATGCAGAAGGGTCTCAGATCCCGGACACACAGTCGGTATTTGGTTCGCTGCCAAGCCAAGCGGCGTCGAGTAA
CGAGTGGGTGCACTCGCAGTGGCACGAGGTGTCCAAGGCCGAGTTTGAGGGCAGCAATGGAAAGGGGCTGTCGGGCAGCG
GACCATCGCCAACGACGTCGCAGCAGTCAGCGGTACAGCCTCTGGGCCCACCGCCGGTGCCGTCACAGAACGCAGCGCCG
CGGCAGAACAGCGGCAGCCGGCTGTCATCGCAGGCATTTCCGATCAGCGCACCCGATGCCCATCTGGACTCGATCCTGGA
CACGATTCTGGACCGGACATCTGGCTGCACGGTGGATCAGCTGGAGCAGATCAGCCGGGAGATCATGGACTACATCTGGA
CGACACGCCACGAGCGGAACCGGTCGCGGGTGATCAGTAACCTGAGCAAGGTGTTCAATCGCACGATTGCCGACATGGAG
GCGATCCAGGGTCTGAACTCGTCCTTTAGCCAGGAGCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62