GenePrediction:GLEAN_3956 Details

Name: GLEAN_3956
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1921819..1922464 (+ strand)
Length: 646
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1921819..1922082 (+ strand)
Length: 264
Type: CDS
Source: GLEAN
Position: GCSC_113:1922144..1922464 (+ strand)
Length: 321
>GLEAN_3956 class=GenePrediction position=GCSC_113:1921819..1922464 (+ strand)
ATGGCCATGTCCTGCCGCTTCGCAGCCCAGCGCTGCGCGCACCAGCTCCGGACGTTACGTTCGACTCGCGTCCGGCCCGC
CGGATCGACATGCCCGCCGCTGGCTGCCGTCGTCTCGCTCTCGCAGGCGGCGGCGCCGCAGCACACAGCCCGGCGGCACA
GCTCGACCGAGGCCGCAGCGGTGGAGCCCAAGATTGCCGCCATTGTCGACCAGATCAGCCAGCTGACCCTGTTGGAGACG
GCCAGCCTGGTGTCGAGCTTAAAGGTTTGGTCCTTCTGTCTTTTCCCTTTTGAGGGCGACACCTTTTTCTCACTCTTTTC
TCCAGACACGCCTCAACATACCAGATCTTCCCGTCGGCGGCTTTGCAGCAGCACCCGCGGCGGCTCCGGCGGCCGCAGAG
GAGGAGGAGGCGCCGGCTGCGCCGGCAGAAAAGTCCCTCTTCACGGTCAAGCTGGTCGGCTTCGAGGCCGGGTCTAAGCC
CAAGGTGATCAAGGAGATCAAGAACCTGTTGGGCCTCAGCCTGGTCGACTCCAAGAAGTTTGTCGAGAGCGCACCCAAGA
CGATGAAGGAGTCCGTGCCCAAAGATGAGGCCGAGAAGATGATTGCCGCCCTCAAGGAGCTCGGCGCCAACGTGACGATG
GAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62