GenePrediction:GLEAN_3957 Details

Name: GLEAN_3957
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1924177..1924651 (+ strand)
Length: 475
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1924177..1924219 (+ strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_113:1924298..1924313 (+ strand)
Length: 16
Type: CDS
Source: GLEAN
Position: GCSC_113:1924383..1924562 (+ strand)
Length: 180
Type: CDS
Source: GLEAN
Position: GCSC_113:1924621..1924651 (+ strand)
Length: 31
>GLEAN_3957 class=GenePrediction position=GCSC_113:1924177..1924651 (+ strand)
ATGCTTCCCACTCGGTGCCTGTTGAAGCGCTCGGTCTGGAAAGGTGCGCCCCGGCTTCCTCCTTCTCGTTAGACGGCCTC
CTCTTGCGCACACAGTCTTGCTAACATCCTCGGCTTCTCAGGCCCGCACATTGTCCCGTACGAGCAACACGACATACCCA
AGCCTGCAATCTATCTCTGCTGAACTAACGTTTCGTCACCCTTTAGTCTCCCCATCACACGGCCACAGGCCGGGAAAACG
TCGCCGCCCATCCGCACCCAGGCCCGGTCTGCAACCATTCTTCCCAACTTCGTCGGCCTCAAATTCCAGGTCTACAACGG
CAAGGTCTACCATGATGTGACCATCACGGAAGACATGGTTGGCCACAAGTTGGGCGAGTTCTCGCCGTACGTCCAGTCCC
ATCTAACAACTATAAGCCCACATCCACCCTAACACTGCGCATAGGACACGGAAGCCGTTCATTTGGTCTCGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62