GenePrediction:GLEAN_3958 Details

Name: GLEAN_3958
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1926125..1927501 (+ strand)
Length: 1377
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1926125..1926340 (+ strand)
Length: 216
Type: CDS
Source: GLEAN
Position: GCSC_113:1926402..1926448 (+ strand)
Length: 47
Type: CDS
Source: GLEAN
Position: GCSC_113:1926499..1926565 (+ strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_113:1926629..1926651 (+ strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_113:1926709..1926743 (+ strand)
Length: 35
Type: CDS
Source: GLEAN
Position: GCSC_113:1926801..1927042 (+ strand)
Length: 242
Type: CDS
Source: GLEAN
Position: GCSC_113:1927106..1927501 (+ strand)
Length: 396
>GLEAN_3958 class=GenePrediction position=GCSC_113:1926125..1927501 (+ strand)
ATGCACCTTCTTGAGCAACTTCTCGGCGTTCTTGCCGTCAGCTTGACGCTCCCACTGCCCACTTCTGCCATGCTAATGCA
TAGCGAAAGTGAACAGAAACGAAACAGCAGCTTCCGGTTCACGGGGGTGAGCGAGTCCGGGGCCGAATTCGGTTCCGGCA
AGATCCCGGGAACGGTGAACACGGACTACGTTTGGCCAGTCAGCTCCAGTATTGATGTAGGTTGGGGCTAATCTTAACAT
GGATGGCATATAACGGACGATGACTAACATATTATAGACACTGATGGAGAAAGGCTTCAACACTTTTCGGGTTCCTATAC
TGATGTCAGTACCAGTTTCGGCTGATAAGAAACTGCCAATGTTAACCAGTTTAGGGAGCGAGCCATTCCTACTCAGATGT
CGGGCACAATCGACGAGAGCTATTTTCAGAATCTCGAAAAGGTCAGTACTTTCAGGCTGTGTCACATCTTCGAAGTTCTT
GAAGCTGACAAATGTGTTACGAAGATCATAACCTATATTACCGGAAAGTGAGCATAGAAGACTCGTCGCTCAGTTTGATG
CTGTATGCTAAACATTTGTCTTAGGGGAGCTTATGCCGTCATTGACCCTCATAACTTTGGTACGTGTGCGCTCTGAGCTA
TAGTCACAAGGCTTCAAAACAGCTTACAGAAAATAGGACGGTACAATGGAAATATCATAAGCAATGTCGCTGCCTTTGAG
GCATGGTGGTATACCGTTGCCAAAAGGTTCCATACCAACAGCAAAGTTATCTTTGATACCAACAATGAGTACCATGACAT
GGACAACAACCTTGTCGCCTCATTGAACCAGGCCGCCATTAAGGGAATACGCGCATCGGGCGCAACGACCCAATACATTT
TCGTCGAGGGCAATATGTGGTCAGGGGCCTGGCATTGGGTAAGTCTGATTTATCCTTCTGTGGACACGCGCCGTATGTCT
GACAAGGCTTTGCCCATAAAGATCTCGAGCGGCACATCAACCGGCATGGGCACCCTCGTCGATCCGTCGAATAAGATCAT
TTACGAGATGCACCAGTATCTCGACACGGACGGTTCCGGCACTTCGACCGACTGTGTAAGTGCCACGGTTGGCAGCGAGC
GCCTCGCAGCTGCCACCAAATGGCTCAAGGACAACAAGAAGATCGGAATTCTCGGCGAAACGGCCGGTGGAGCGAACAGC
CAGTGCATCTCTGCCCTGCAGGACATGTTCCGCTACATGGAGAAGAACACCGACGTATGGGCCGGCTGGCTTTGGTGGGG
AGCCGGCCCGTGGTGGGGACCCTACATTTACAGCATGGAGCCACCCAGTGGCGTGGCTTATACTGGGGTGCTGCCCAGTA
TCACCCAGTTCATCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62