GenePrediction:GLEAN_3959 Details

Name: GLEAN_3959
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1927851..1929410 (+ strand)
Length: 1560
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1927851..1928040 (+ strand)
Length: 190
Type: CDS
Source: GLEAN
Position: GCSC_113:1928107..1929410 (+ strand)
Length: 1304
>GLEAN_3959 class=GenePrediction position=GCSC_113:1927851..1929410 (+ strand)
ATGGCTGTTGACGAGGAGGGCGGCGTGTCTCTGAAGAGAGGCGACCGGCCCATGGATCTCGACAACGACAAGGACACTGC
CATGGGCGAGTTCGAAGACGAGTTCGAGGACGAATTCGACGATGATGAGATTATCGAGGCCGGTGTTGACGGCCGCCCAG
ATGCGGAGAGAGAAGCAGAGGAGAAAGAAGGTGCGTGACGTGCAGGATGCTGTGAGCTAGAACAGCTGTGATCGAGTCGC
CTGCTGACGGGCCTAGCTGCCATGGACGTGGACAACAACCCAGGCACATTTATCGTAGGGCGGACGAAGCTCGAGCCCGG
CCAGGTGCTGGCGCCGGATCCGAGTGCGTACGACATGCTGCACAGCCTGAACACGCCGTGGCCATGTCTGTCGTTTGACA
TTATCCGCGACCAGCTGGGCGCCGATCGCAAGGTGTACCCGGCCACGATGTACACGGTAGCCGGGACGCAGGCGCAGCAG
GCCAAGAGCAGCGAGAACCAGCTGATGGTGCTCAAGTTCAGCGGACTGGGACGGATGCAGAAGGACGACGGGGGCGAATC
GGACTCGGACTCGGACGACGACGCAGACGGCGAGGACAGCGAGCCGATCCTAGAATCGAAGAGCATCCCGCTGAGCTCGA
CGACGAACCGGGTGCGAGCTTTCCAGGTAGCATCAGAGGATCCGTCACGGGCGCCGACGACGCTGACGGCGACGCTGACA
GAGTCGTCCAACGTGTTCATCCACGACATCACGCCGCACCTGGCTGCCTTCGACACGCCCGGCACGCTGATCACGGCCCA
GCAGAACAAGCCGGTCTCGACGATACGCGCACACAAGGCCGAGGGCTACGCCGTCGACTGGTCGCCGCTGCACCCGGCCG
GCCGGCTGCTGACGGGCGACAACGACGGCGTCATCTACATGACCACGCGCACGTCCGGCGGTGGCTTCGTCACTGACACG
CGCCCCTTCCTTGGCCACACTAGCAGCGTCGAGGAGCTGCAGTGGAGTCCGTCTGAGGCATCCGTGTTTGCGTCCGCCTC
GAGCGACGGCACCGTCCGTGTCTGGGACGTGCGCAGCAAGAGCCGCAAGGCCGCCCTCTCCGTCCAGGTCAGCACCACCG
ACGTCAACGTCATGAGCTGGTCGCGCCAGACGACCCACCTGCTGGCCACGGGCGCCGACGACGGCGTCTGGGGCGTCTGG
GACCTGCGCCAGTGGAAGCCCAGCGCCGGAGGCGCTGTAGCCGCCGTGGCTGACCGGCCCAGTCCCATTGCCAGCTTTGG
CTACCACAAGGAGCAGATCACGAGCATCGAGTGGCACCCCACCGACGATAGCATCGTTGCTGTGGCTGCTGGCGACAACA
CGGCCACGCTCTGGGACCTGGCTGTCGAGCTCGATGACGAGGAGAGCCGAGATACTGCCGGCGTGCAGGACGTGCCGCCC
CAGCTGCTCTTTGTCCACTACCACTCCAACGTCAAGGAACTTCACTGGCACCCCCAGATTCCCGGCACGTTGGTGGCCAC
CGGCGACGAGTTCAGCATCTTCAAGACCATCAGCGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62