GenePrediction:GLEAN_3960 Details

Name: GLEAN_3960
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1930384..1931729 (+ strand)
Length: 1346
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1930384..1930429 (+ strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_113:1930709..1930851 (+ strand)
Length: 143
Type: CDS
Source: GLEAN
Position: GCSC_113:1931073..1931729 (+ strand)
Length: 657
>GLEAN_3960 class=GenePrediction position=GCSC_113:1930384..1931729 (+ strand)
ATGCAGCCTGCTGGAAGTATAAAAGACATCGAATTCATAGGAACTTGTCCAACCGGCTGTAAAGATGGTGAGACGCAAGC
GACAAACGCCGAAGACGGCCTCCAGTCGAAGAAGGTCTCAGCTTTCAATTCACTCGGATGGTTGGACCGCTTTCTCGCCG
TCTGGATATTCCTAGCCATGGTTGTAGGTGTTTTACTGGGAAACTTTGTCCCCGAAACAGGGAAAGCTCTACAAAAAGGC
AAATTCGTCGGAGTCTCCGTGCCAATAGGTGAGACTGGGCGAGCTCGACACTGTCATGTTTTATGGACTAACCAGACATC
TGCAGCTATTGGACTTCTCGTCATGATGTATCCCATCCTCTGCAAGATCCGTTATGAGTCGCTCCATGAGGTGGCATCAG
AACGCGGCCTGTGGAAGCAGCTGGCCTTCAGTATCTGCATAAACTGGGTTGTGACACCGCTGTTTATGGTATTTATTCGT
CCTCCACCGCCGAAACATGGCAGACAGGCAAAATCTCACCTTCTTTTATCAGCTGGGCCTCGCATGGGCCTTTCTTCCAG
ATAGAAGCGATCTGCGAGTTGGGTTGATCCTCGTGGGACTTGGGAGGTGCATAGCAATGGTAGGTGCTGTAATCGCGAAA
AATTATGTTGAAGTAACGATGTCGTCCTGACATCCTGACCAACTTGCAGGTTTTGATATGGACAGGCCTGGCTGGTGGCA
ACGCAGAATACTGTGCCATTCTTGTGGCCGTCAACTCGCTTTTGCAGATCGTGCTCTTCGCGCCGCTCGCCATCCTCTTC
ATACGCGTCATCAGCCATGATACGGGCGCATCCGCCGTGTCCTACTCCGTCGTTGCAACCAGCGTGGCGGCCTTCTTGGG
AATCCCTCTGGGCGCCGCCATGGTGACCAGATTTGGCCTGCACGCCATTGCCGGACCAGCCTGGTACGAGCGTGTGTTTC
TTCCGGCTGCGGCACCGTGGTCGCTCATCGGCCTGCTGTATACGATCCTCGTGCTGTTTGCATCGCAGGGACACGCCGTT
GTGCACCAGATCGTCAGTGTCGTCCGCGTGGCTGCCCCGTTGATCGTCTATTTCGTCTTGACCTTTTTCGGTACGCTGTG
GATCACATACCGCCTGCATTTTGGGTATGCCCTGGCGACCGTGCAGAGCTTCACGGCTGCCAGCAACAACTTTGAGCTCG
CCATCGCCGTCGCTGTCGCCACGTTTGGTCCGGACAGCGACCAGGCACTGGCAGCCACGGTTGGACCGTTGATCGAGGTG
CCGGTGCTACTTGCGCTGGTGTATCTGGTGCGGTGGATCGGCAATCGGTGGAAATGGGAGCCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62