GenePrediction:GLEAN_3961 Details

Name: GLEAN_3961
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1933010..1934777 (+ strand)
Length: 1768
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1933010..1933117 (+ strand)
Length: 108
Type: CDS
Source: GLEAN
Position: GCSC_113:1933206..1933415 (+ strand)
Length: 210
Type: CDS
Source: GLEAN
Position: GCSC_113:1933470..1933662 (+ strand)
Length: 193
Type: CDS
Source: GLEAN
Position: GCSC_113:1933715..1933868 (+ strand)
Length: 154
Type: CDS
Source: GLEAN
Position: GCSC_113:1933937..1934118 (+ strand)
Length: 182
Type: CDS
Source: GLEAN
Position: GCSC_113:1934197..1934597 (+ strand)
Length: 401
Type: CDS
Source: GLEAN
Position: GCSC_113:1934757..1934777 (+ strand)
Length: 21
>GLEAN_3961 class=GenePrediction position=GCSC_113:1933010..1934777 (+ strand)
ATGATGCCTCCCTCTCTTCAGATTGACGAGTCCCAGGACCGTAGCACAAACTCGATTCATGGCCTCACAGCCAAGTCAGA
AGAGAGCGTCAATAAGTGGTTGAAATACGTGCGGGGAGGATTCGCACCGTTTCCGGTACTGTGGCTTCTCGTGAATGAGT
GCCAGTATATGCAGTTATTCTGACTCTCGGTGATAGGTGGTTTTTGAGAGCGCTGAGGGCAGCACCATCACCGATGTCGA
CGGCAAGAAGTACATCGACTTCATAGCGCAGTTTGCGGTGATGAGCTTTGGGCACTCGCACCCAAAGATCATCAAGGCCG
CTGTTGATCAGCTGCAGAAGCTGCCATTAGTCAACACGAGCTATATCAACCCGCTCTACGCAGACTTTGCAGAACGTATA
ACGAAGGTACGTGAAGTCGTCCTTCTCCACCTGTTCGCTCCTTCAACTGACACCGAGCAGAAATTCAACTATGACTCCAT
CACCTCCATGTGCACTGGTGCCGAAGCGGTCGATGGGGCCTGCAAGATCGCCCGGAAGTGGGCGTATGTGAAAAAGGGCG
TCCCAGCGGACAAGGCTATCATTTTGACTGCAGACTCCTGCTACCACGGGATGACTCTCTCCACTATGAGCATGACGGAT
AGTATATTAGAGAGTGAGTACAACGGCTAAATTGGGACATGACAGCATATACTCACAGTCTATAGACTTTGGCCGGCACC
TGCCGAACGTGGGTCCCTTTGCACCGGAGAGCGGCAAGCTGATCAAGTTCGGTGAGACCGACGTGCTGAAAGAGACGTTC
GAGGCCAGTGGGGACGTCATTGCTGCTTTTGTCGTCGAGCCGGTGCAAGGCTCGGCTGGGTAAGGATATTCCAGCCTCCT
ATCACTAGTAGCTTCTCGGAGACACACAACTGACATATGTCCTGCAGATGTCGCGTGCCCCCAGAGGGATACTTGAAAAC
GGTGCAAGATCTTTGCCACAAGCACAATGTCCTCTTCATCTGTGACGAGGTGCAGAGCGGCTACTGTCGGACAGGAACCG
ATATGGCCTACCAGCAGGAGGCTGGCGTGCAGCCAGACTTGATAACTCTGGGGAAAGCCGTCACAGGAGGTATGCACGGA
CACACCCCCATGGATCAGTTGAATACCACAGTCCCGAGCTAACTTAGATTTCTTCTCCTTGTCACAGGCCTTTATCCAAT
GTCGATAATCATGGGAAAGAGCCATGTCATGGACACATTGCGCAAATATGAGGTCGGAAGCACATTTGCGGCATCGACCG
TTGCCTGTGCTGCCGCTCTAGCCGCGCTAGACGTGATGGAAGAGGAGCAGCTTTCGGAGCGGTCTAAGCGGCTCGGTGTT
GTGCTCACAAAGGCTATTGACGATGCAAACCTCCCGTACGTGACTTTGCACCAAGGAAGGAACAGGGGCCTCTTTCAGAC
CCTGACTGTGGACGAATCGGCGCCCAATGTGACGGCAAGGCGTATTGCGGCGCTGTGTGCATTAAGAGGGATGCTCTGCG
GGTGCAGCTCAAATCGCCTCCGGTTCAGCCCTCCTCTTGTGATTTCTGAGACGGAGATCTTGAAGGGGGTGAGCATTCTG
GCATCAGCCTTCCGGGACGTTTCTTCTCTAGGTGATTTCCCTGGGTCTGTATTTATAAACCTATGAACGAGTTTGGGAGT
CGACGACTGTGCGGTAAAGACATGGTGAACAGTAGTGATGAATACAGAAGAGGCTGATAACCAATAGAAAACAAGTCTCG
CCATCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62