GenePrediction:GLEAN_3962 Details

Name: GLEAN_3962
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1940032..1941611 (+ strand)
Length: 1580
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1940032..1940371 (+ strand)
Length: 340
Type: CDS
Source: GLEAN
Position: GCSC_113:1940457..1941064 (+ strand)
Length: 608
Type: CDS
Source: GLEAN
Position: GCSC_113:1941248..1941375 (+ strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_113:1941429..1941611 (+ strand)
Length: 183
>GLEAN_3962 class=GenePrediction position=GCSC_113:1940032..1941611 (+ strand)
ATGGTCCATCGCCTGCACAGCAAGTATGGCGACTTTGTCCGCATCGCCCCCAACCATGTCTCCATTGCTGATCCAAGGGC
TCTGCAGGACATTTACGGGCACAATACCGGCTTCGTCAAGGGCCCCTTTTACGACGCCTTTCACCAGACAGAGCCGGGCC
TGTTCGGCTTGCGCAATCTCGACATGCACCAGAAGCGGCGGAAACTTATCACGCCTTTCTTTTCTCCGGCCAACCTGACG
GCATTTGAACCCCAAGTTAGTGCCAGCGTGCTCAAACTAAGGCAAAGTCTTTCCGGCATAGCCGCGTCCGAACAACCAAC
GACGAATTTTAGCTTATACGGTAGGTACATCGTCTATAGTAGATGCATATTGGCGATTCTATCTAACCGGCTAGCGAACT
TTCTTGCCTTTGGCCGCACGTTCAGGCTTCCTGGACCGGGGCTACGACCACTCAAACCTGATCGAGTCCCTAGACTCCCG
CGGTTTGGTTGTCAATGCCCTCGGCTACATGCCGTCGTGGTGCCGACTGCTGATGATGTACAACTTCTTTGGCTACTTTT
GGCATCGCGGCCTGAGCGGACTCTGTCATCTTGGCGTTGTCGGCCGCACAGCGTATTTTTCGCGCAAGGCTGGTACGGTG
ACGAGGGATCGGAAGGATGTGCTAAGCTTCGTGATCGAACCCGGAAATGAAAAGGCGGCCGGCGCATATTCTGAGGTCGC
CCTGGTTGCCGAATCGGTCGGTCTTATCATCGGTGGCAGTGACACGACTAGCAGCACCATGACGCACTTTGTCGATCTCG
TTTCGCGTGATCCGCTGCTACAAAAACGGCTGCAAGACAAGCTCGACGCGGCGTTCCCCGGCGTTGAGGGTGAGGGCAAC
TGGGTGGCCGATTTCGCTACCGCGGACAAGCTGCCTATTCTCCGTGCCACGCTGCGCGAGACGATGCGACTGCGACCGAC
TAGCGCGACTGGTCTAGAGAGGGTCACGCCGCCAGGCGGACGGGTGGTGGCGGATGTTTCTATTCCTGCTGGGGTAGGTT
GTCCCTAAAAACAAGACAGTGTCGATGCTCTCCAGGTCTAGAGGTGCTGACCACCGGGATATCGTAGACACTGGTTAGCG
TTCCTATTAGAACGATCATGATTGACGCTGGTATTTTTTAGGTGTGTTTGGTGGTAGTATAGAGATGGAAGTAGACACAA
AACAGGTGGAGTCCAGCTAACCTGCGTGCCATCAAAGGATCCGACCGACTTCAACATCGACAGATGGTTGCAGCCCGACG
CTGGCCAGCTTTCCGAGTACTTTAAACCATTTTCACTCAGGCCTCGATCATGCATTGGCAGAAAGTGGATTCTACACTGT
CTGTGTTTACTTTGTAGTCCGGTACTGACGTGAACAGCTTCGCCTGGATGGAGGCTATCAAGACACTGGCCGCACTTTTC
TGCCTACTTAACTTTTCCAGAGCACGGAATGGGCCCACTGAGCTGAAAGAGGGCTTTATCCTGAAGGTAAAGGAGTGTAT
GGTACGTGTTTCTCGGCGGGACATCGACAGAATAGTAACTTTCTCCGATGTGGAGAGCCC

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62