GenePrediction:GLEAN_3965 Details

Name: GLEAN_3965
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1957037..1958825 (+ strand)
Length: 1789
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1957037..1957188 (+ strand)
Length: 152
Type: CDS
Source: GLEAN
Position: GCSC_113:1957247..1957539 (+ strand)
Length: 293
Type: CDS
Source: GLEAN
Position: GCSC_113:1957599..1957921 (+ strand)
Length: 323
Type: CDS
Source: GLEAN
Position: GCSC_113:1957975..1958097 (+ strand)
Length: 123
Type: CDS
Source: GLEAN
Position: GCSC_113:1958146..1958233 (+ strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_113:1958286..1958435 (+ strand)
Length: 150
Type: CDS
Source: GLEAN
Position: GCSC_113:1958488..1958825 (+ strand)
Length: 338
>GLEAN_3965 class=GenePrediction position=GCSC_113:1957037..1958825 (+ strand)
ATGGCAGTCTTGAGGAGCTTGTTCTTGCTGCAAGGCATTTTCACAGGCATCTTTGCAGCGTCCTTTGTACAACAAGCCAC
GGAAGATGCCTCTACTTCCGACTATACCTGCACCGCGACTAGAGGCTGTGACATTGGCTGCTGCGGGCCTTTGTAAGTCA
ATCTTGACCATCATCGCTGTCTCGACCCTGTTTTCTAACGACCTGCGAAGAAATGCAACGGGCGGCGGTGTGTGCGGCGC
CGGCCCGGATTACTGTGGCGACAAGTGCACGTCGCAGTGCTCGTGGAAGAGCGAGTGCGACCCGGGCTGGGGCCTGCAGT
GGTCCAACGCGTCGACCTGTCCGCTCAACGTCTGCTGCAGCAAGTATGGCTTCTGCGGCACCACGTCTGACTTTTGTGGC
AGCGCCGTCGTGTCTTCGCCCCAATGCTCCGGAAACAAAGTTCTGACGGCCGGACGATTGGCTACTACGAGGGCTGGAAC
GGCCAGCGTGCATGTGGCAGTAAGTGAGCTGTGTATGCTTTATGCTGTATGCTGTTTGCTGCCTGTTATGCTGACCTCAC
AGCCATGTCGGCCAGCCAGATTCCCCTCGGTTATTATACACACATCAACTTTGCCTTTGCCCTGATCGACCCGACCACGT
TCCACGTCGTGGCCATGGACTCGGATACGGCCAGCCACTACGACGCGGTGACTGCGCTCAAGGCCGAGCAGCCCGGCCTG
GAGGTCTGGATCGCCGTTGGCGGTTGGGCCATGAACGACCCGGGTGCGTACCGGACGGCCTTTTCCGACGTGGCCAAGTC
CGAGACCAACCAGGATGCCTTTTTCGAGTCCCTCATCATGTTCATGCTGACACACGGCTTTGATGGCGTGGACATTGACT
GGGAGGTATGATCCTTGCGATTGTCTCCTCCGTACGATACAGGCTGACCATCTCGCAGTATCCCGTGGCCGACGACCGCG
GCGGAACCGAGGCTGACTTTGACAACTACGTCAACATGCTCAAGCGCCTCCGGACTCGGATGAACGGCAGCGGCCATCAG
TTTGGTCTGAGCATCACGCTTGTAGGTTTCATGCCCAAAGCTGGTGCTACCGAATGCTGACTAAGCAAGCCCTCCTCATA
CTGGTATTTGCGCGGCTTCGACATTGTCAACCTAGAGCCTTACGTGGACTGGTTCAACATGATGACATACGACATACGTA
GGTTTCTCTAAGCTTTACAAGCATGAGTGATCACCATCTGACAAGACAGACGGTGTCTGGGACAGCACGGTCCAGTCCAT
CGGCTCGTTTGCGTATGCCCACACCAACCTGACTGAGATCAGCACCGGCCTCGAGCTGCTGTGGCGCAACAACATCAACC
CAGAGCGCGTCAATATGGGCCTTGGTTTCTATGGTCGAAGTATGTGCGCTTCTAGCCTCGCGTGCTGACAAGTATGGCTA
ACAATGCACAGGCTTCACCATGGCCGACCCCAGCTGCATGACGGCCGGCTGTCCCTTTACGTCTGGAGCCAACGGCGGTG
AGTGCACTGGTACTCCCGGCGTGCTGTCGGCCGCGGAGATCGTCAAGATCATTGCTGCCGGGGCCACGGTGACGTTCGAC
CCGGTGGCTGCCGTCAAGATCGTCACCTGGGACACGAACCAGTGGGTCAGCTGGGACGATGCCGAGACGCTGAAGCTTAA
ACAGAACTTTGCCAACGAGCGTTGTCTAGGAGGGTACGTTGTCCTGTTTGAGGGAAGGCCGCGCATCAGGAATAAGCTAA
CGAGACAGAACGATGGTGTGGGCGATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62