GenePrediction:GLEAN_3966 Details

Name: GLEAN_3966
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1961212..1963223 (+ strand)
Length: 2012
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1961212..1962032 (+ strand)
Length: 821
Type: CDS
Source: GLEAN
Position: GCSC_113:1962092..1962332 (+ strand)
Length: 241
Type: CDS
Source: GLEAN
Position: GCSC_113:1962385..1962726 (+ strand)
Length: 342
Type: CDS
Source: GLEAN
Position: GCSC_113:1962783..1962919 (+ strand)
Length: 137
Type: CDS
Source: GLEAN
Position: GCSC_113:1962980..1963223 (+ strand)
Length: 244
>GLEAN_3966 class=GenePrediction position=GCSC_113:1961212..1963223 (+ strand)
ATGAAGTCCGTTCTGCTTGCCGCGATCGGCCTGCTTGCCGGCTGTGCTGCCGGGCAAGAATCGACTCCAGGGGGCCCGAC
ACAGACAGGCACCATCTCGACATGCGACGAGTGGTATGTCGTCCAGAGCAACGACACGTGTGAGACTATCGAGAGCAGCT
TTGGCATCACACTGGCCCAGTTCTTGGCTTGGAATCCGGCCGTGTCCAGCGACTGTACGACCAATTTCTGGAGTGGCTAC
TCCTACTGTGTTGGCGTGTCTTTGGTGACGTCGTTGTCAGCCACAAGGACGCAATCCAGCAGCCTCTCTGCGACAACGTC
CGTGCCGACAGTGACCAGTCCTCCGGGCCCAACTATGACTGGCACAGCGTCCAATTGCGACAACTGGTACCTAATAAAGA
AAGGTGACACGTGCGCCACCGTCGAATCGGCCTATGGCATCACACACGCCGAGTTCATTGCCTGGAACCCAGCTGTCAGC
AGCGACTGCGCAACCAACTTCTGGACCGGTGAGGCCTATTGTGTCGGTGTCGGAGCTGTCCCATCCAGCATCGTTTCCAG
CTTCGTAAGTAGCCTCGTTTCCAGCTCCGCCATCAGCTCCAGCATCAACGCAACAGGCAACGCGACAATAACCCCCTACT
CAACACGCTTCCCGGTGACGTCATGGAATATCTCGTCGCCCACGGTCGGCACGACATGGCCGCCTACCCAGACACAGGCC
GGCCAGCCTAGCTACTGCAACTACTGGCATCTGGTGCAGCCAGGCGACACCTGCTCGACCATCGCGTTCGCCTACTCCAC
CTGGATGACCCTGGCCGACTTGTGAGTATCGAGCTGCGGCCCTATGACCAGTTTCAAGCACGCACCACTGACATGCGTAG
CTTTGCCTGGAATCCCGTCGTCGGCGCCGACTGTACCGGCCTATACGTTATGTACTGGGTATGCGTAGGCATCCAACCGC
AGACATCGCTCACGCTCGAGTATCCGACCACCACGCCAACCATCCCGGACGAGGTGCCGTGGACGCCGACGCCAACGCCT
TCGATCGACTACAGCTTCACTCCGTCACCTACCCAGGGCCCGCTACCGACAAACTGCGCAAACTACTACTTCTCGAGAGA
GGTGAGTGCTTTTCTTCGTCGCAAATTAGCTGGACACAACTGACCCATGGCAGAATGACACCTGCAGCGTCGTGGCTGCC
GAGCTGGGCTACATCACGGAGGACGAGTTTCTCTCCTACAACTCCTATCTCGACGGCAACTGTAACGGCCTGTGGTCCGG
TGTGTACTACTGTGTCAGCGAGTGGTCCGGCTCACAGAGCGACCTGCCTCCGCCGCCAACAGTCAGCGCGAAGCCGTCCT
CGGCTCCCAGCGACACCATCTCGACATGCAACTCATGGTACCAGACCAGTGGCGATGACGACTGTGCTGTCGTATCGGCC
ATCTTCGGCACGTTCTCTGCGTCTGACTTTATCAGCTGGAACCCGAGTGTCGGCGAGGGCTGCACAGAACTTGTGGTAAG
ATTCGTCTCACCTTGGTGTTGACACAACCCTAACTCCATCTGCAACCATAGCAAGACACCTACTATTGTGTCTCTGTCCC
CGGCACGCCGACTACTCGCACAGCTATCGTGACGCCCACACCCACAGCTACTGCGCCCGTACAAACGGGAATTGCTTCGG
ACTGCAACAGCTGGTGGCTTGTTAAAGAGTGTGTGGCGTCTCTGTTTCCTCTTCACTGCCAAACTCTGCATGCCTGCTAA
CTGGCCAGTTCCGATACCTGCGATATTATTATCACGGCCAATTCTCTCACTCTGGAGCAGTTCCTCGATTGGAACCCGTC
CGTCGCCAACGGTACCAGCGATTGTGCTCAGCTGCTGCCAGACTATGACGTCTGTGTTCTGCTCGATGGCATGGAGCCAG
GCGGCAACACCACCACCACGGCCAGCTCTACTAGCATAGTTTCAACAGTACCGGCCTCGACCCAGTCGAGCAGCGCACTC
TCGACATCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62