GenePrediction:GLEAN_3968 Details

Name: GLEAN_3968
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1980998..1981559 (+ strand)
Length: 562
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1980998..1981429 (+ strand)
Length: 432
Type: CDS
Source: GLEAN
Position: GCSC_113:1981491..1981559 (+ strand)
Length: 69
>GLEAN_3968 class=GenePrediction position=GCSC_113:1980998..1981559 (+ strand)
ATGGTCACCATCCATCTCGCTGTCACCGTGCCGGTCAATGCCCCGGGAGCATCACTTGTGCTATCCCAGGTGCAGGTCTT
TGCTGGATTTCAACGCAAGATCCGCCAGCCCCAGGAGTTTGCGCCGGCCATAGCCAAAGCTGAGGTGCTGAGCGACGTTG
GCGGCGTGGTGAAACGCCGCGTGACCTTTAAAGCCCCATCAGCACCTGACACCGGCGGCCATCCGGCTGAAGTTCTTGAG
ACGTGCACAGAGCTGGCGCCCAGCCGAGTGGACTATGAGCTGGATAATGGCAGCACAGTGTTGAACATTGTCAGCACTGG
TACTAGTGGCAAGCCGGAAGATTTGTACGTGACGTATGTGTTTGCTTGGAAGCACGCCGACCTCGAGGCTGGCAGCATGG
CTGCACGGGAGGTACAGACTAGCCATGAGAAGGTGAGTAACGGGGCCCATGTATGTCGAGAATTCTGGTGCACCGACGCT
TACACAACCACAGATCGCCAAAGTCGTTGTTGAGTCCAGCATCGCTACTACGCGTCGGCTGGTGAGCGAGGGAAAAATCT
AG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62