GenePrediction:GLEAN_3970 Details

Name: GLEAN_3970
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1987914..1991677 (+ strand)
Length: 3764
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1987914..1988113 (+ strand)
Length: 200
Type: CDS
Source: GLEAN
Position: GCSC_113:1988241..1988312 (+ strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_113:1988485..1989237 (+ strand)
Length: 753
Type: CDS
Source: GLEAN
Position: GCSC_113:1989322..1989515 (+ strand)
Length: 194
Type: CDS
Source: GLEAN
Position: GCSC_113:1989629..1989907 (+ strand)
Length: 279
Type: CDS
Source: GLEAN
Position: GCSC_113:1989982..1990727 (+ strand)
Length: 746
Type: CDS
Source: GLEAN
Position: GCSC_113:1991498..1991677 (+ strand)
Length: 180
>GLEAN_3970 class=GenePrediction position=GCSC_113:1987914..1991677 (+ strand)
ATGTCGATTGCGCCGTCTTCGTCCGTTGAGCGATCTCCTCGCGCCAAGCCGCGGCCAGCAGCCATGACCGTGGCGGCTTC
TGCTGCGTCGACGCCGGCGGCCGACATTCCGAGATTCCGCCCTCGCGCCTGCGCCCGCTGCAGCACATCGAAGCTCAAGT
GCAACTGGGTGTCTGAACCTGGAGAGGCGCCTTGCGAGAGGTGTGTCTCGTCCTTGGTGCCGCTTTTCCTGCGCTTCTCT
CTCGGCGGTCCTTCGGGAAGCTGCCAGCTCGACGGAGGAATTTATTTTGACACTTGAGCAAGCTGATGCTAACCTTCTGC
ATCACAGATGTGCCAAGAGCAAGACACAATGTGTGCTCCCGAGTCTGAAGCCCCGCGGACCCCGACGGGGTAACCCAACG
TAGGTATATCTCTGCTCGTCGTTCCTGACTTTTCAACCTCACACAGATCAGCAACAAAGGGTCCCCGTTCTTCCTCCTTC
CTCCTTCCTCCTTCCTACTTCCTTTCACTTTCACCCCACCCCTTGGCCACCCAGACGAGACTACATGCTGACCATGTGCG
CCTGGTGGAAGCCGTGTGGGGCAGCTGGAGCAGAAGATCGACGGGATCATGTCGCTGCTGACAGCCAGCCAGCAGATCCA
AAAGGGATCGTCTCCTTCGGCACAACCACAACCACGGGCGCCGTCGACGCCATCCGACGATCCGGATGTCCGAGATCCAC
ACATAGTGGGTCCGGCGCTCTCGTCGCCCCATTCGCCCGAATCTAGTCTTCCGCAGTACGACTCCACGGCCACGCAGCCA
CTGACTCCAAGCACCCCGGCCGCTTCGGCCACTACCCCGTCCATGTCGCGGGACTCGATGTCGGCCATCACGGCCGGAGG
GCCACAGAGCACGCCGTCATGCTCGCATCAGCAGCATTTGTTGCAGCAACAACAACGACAACTACAACAACAACAACAGC
AGCAGCAGCAGCAGCAACCGCTGCCACCCGCATCGCTCGTACGGGTACCCCCTCTCGAGCACGTTGAGATCGTCCCGGGG
CTCAAGATCACGTTCCACGACGCTGAGATCGCGTTGGCAGACTATCGCCGCCTCTACAGCCCCTACTTCCCCTTTGTCCC
GCTGGCCTACAACGTACCGGCCCATGAGTTGTACCACACACAGCCGCTGCTTTTCCGCATCCTGGTCCAGGTGGTCCTGC
CCCAGTCACCGCAGATGCAGCGTGATACCCGGCGCTGGATCCGCGAACAGTTGGCCCACCACATTGTCGTACAGGAGGAA
AAACACATTGGCCTGCTGCAGGCCATTCTCGTTCACCTCGGCTGGTACTGTACCTCTTTTGTCCTTTGCTCTTGCTATTT
CGGCAGTCTGCTCTCAGTTTGCTGACAGCTTGCTCTCCTGCCGTCCAGGATAGATTTGGCTTACTATATGGAGCCCAACA
CGACGCCAGTGCTACAGCTGGCCATCGGGCTCGTTGTCGACCTGGGCCTGCAGAGGGCACCGACGATGATGCGGTTGATG
CCGGCCAATTTTGTCAACGACGCCGTGAACACGCTCAAGGGCAAGAGCTTCGGCCCGAAAGAGCATAGCCTAGACGAGAT
GCGTGCCGTTCTCGGATGCTATTATATATGCGCACTGTGGGTTTCAGACCCGGCCGTGACCTTGCTACGTGTGCGGCTGT
ATGGACAGCTGCTGACTCGCGACACAGATCCACAGTTCTCTTCCGGCGGACCCAAGCCTTGCCGTTCAGCACATACCTGG
ACCACTGCTGTCGCGTACTGCTGGACGCGCACGAGCACGAGTCGGACGCGTTCCTCGTGGTCATCGTGCGGCTGCAGCAG
ATCGCTCACCGCATCTACGTTGTGCTGCCTAACCCTGACAGCGACCCGCGATTGGCCTCCGGTGGCTGTGCGGCCATGTT
CATGTCCATCGCGGTTCTTCGACGGGATCTGGACGCGCTGATACACAGTCAGCCTATGGAGGTGAAAAACAACTGTACGC
TGGCTTTACGGTTGCCTTTATGCTTGTCGGTCTTGCTGTTCATTACCGCTGACACTTGCTCGTCCCAGTCTTCTTGCGGA
CAAACTACCACGCCATCGTCTCGCGACTGTACGAGCCGGCTATCTACATGCGGGCGTCCGGCAGGACACCGGCCAACACG
ATAGACCCGGCCGACGCAGCCGAGCGCACGGCGTGCCTGTGGAACTGCCTTCAGGCGCTACGCGACTTCTTCGAGGCACA
GGCTAGCATCCCGATCGACATTTTGGGCAGGCTGCCGTTCTCGGCAGCGACGCATCTCGCCTTTGCCGTTGCCACTTCCA
TGCGGCTGCTCTTTTTGCTGGACGACCCAGATTGGGACGTGGTGCGGGCACGGCGCAGCCTGGACTTTGTCGCCATCACC
TTGCGTCTGGAAGAGCACTTCCAGGCGGCAGAGGACTTTGAGGATGCCCCGGCCAACACCCAAGGCCTCGGCCGCAAGAA
GCGCTACCTTTCGGACGACAACCGCGCCGTGCTAGCCATTTTCCGCGACAAGATGCGCTGGATTCGCCTGTGGTACGCGT
CCAGGCTACCGATGGAACAGCGCGGCATGACGGATGCGGCAGCCACATCTACGGCCACCGGCACGGCTACGCCCATGTCG
GCCGCCGGGACCTCGGACGTGGCCGGGGTCCCGTCACTGCTGCCCATGCCGTCATTTCTGCCCCCGCGCCCACATACCGG
GCAGCAACAAGGCAGCTTCATGGACGTGGACGGCCTCGGGGCTGTCAGCTCGTCCGACGAATATGACCTTATGTTCTGGC
AGTCCATCTTCACTGTGGATGGGCCGTGGGATCCAATGCAATTTAGCTGATGAAAACAGAATAGAAATACGACAGCAGAA
TGGAAATACAGGGAAACGGAAGAGCGGACAGTCGCAGACAAGGATCTAACAGAACAAAGACAACCAGAGAGTGATGGACG
TAAAACACGGGAAGCGTAAGAAATAGCCACAAATATGGCCATCCGTCTATCTGATCGGTCCACCTGACCAGACGTTCTTT
CGCTTTAGCCTTTCTAGCCTACAGTACAGGCGGAAGGAGCACTAACAGTGAGACTGATCTGATATACGGCTTGTGTGCCA
ATGGCAGTCGGAAGTTCGGCGTACGGGATTCTCTCGGCGACGAAACAGTAGGTCTCAGCTTTGACGAATGTCTGTCACTC
CTTTGTCCGACAGGCAGTTTAAATTGAACGCGGGAATGATATTAATACTCAGTCATGCATATTGTCCTCATACGCCTTGG
GACAAGCTTTTGTATCAGCCGAATGGTCCGTGCGTGCACCATGGCTTATTCAGGCGAGTCCGAATACACCACTTGTCTGT
GACGCGAAGGTGCCGCCTTCACGTTATACTAGTTTAAAACCTGTACAGTGATGTTCGTGTTAAATACGTCCGGAACAGTT
GCACGTCCTGTAGAGCTCAAAGGACTTCAGAAGACCTAGTGCTGATATTTCAAAAGACAGGGAAATCCATGCGTATTACA
ACACTGTGTCTGGAGCTTTGTGTGTGTTTCTTGCCGTTTTATAACATTCAATCTCCTTCCCCAGCACCTGGACCCGCTAT
GGCTGATCATGGCGACGCTCCTAAACTGGTACCACATCCCGCAGAACTCCTCTACCCTCGAAAGCTCCGGTGTGCCGCCC
GTATGTTCTAAGCTCTGCCGTAGTGCTGTCGGTGAGATCGTGTTACGTCTGGAAAACGGCAGTGGTGGCAGCGGGAGCGA
CTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62