GenePrediction:GLEAN_3971 Details

Name: GLEAN_3971
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2001271..2003915 (+ strand)
Length: 2645
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2001271..2001425 (+ strand)
Length: 155
Type: CDS
Source: GLEAN
Position: GCSC_113:2001536..2001899 (+ strand)
Length: 364
Type: CDS
Source: GLEAN
Position: GCSC_113:2001973..2003413 (+ strand)
Length: 1441
Type: CDS
Source: GLEAN
Position: GCSC_113:2003467..2003915 (+ strand)
Length: 449
>GLEAN_3971 class=GenePrediction position=GCSC_113:2001271..2003915 (+ strand)
ATGGTATCTATAACCAAAGCCCACCTTCCCTCCATCTTGGTCTTCGGTCCCCAGACCGAGCTTCCCCTAGAGAAATCCCT
CCAGGACTGCCGTCAGGAGCTCGTCGAGAATCCTCGTCTGTCCGCCCTAAGGGCTGCAGTTGGCCAGTTGCCAGAGTTTT
GGCAGGGTCTGGTTGGATTTGATCCCAGTCTGAAGGACGTCCCAGGAGACAGATATCTCACGAGACATGGGTGGAAAATG
GGGGCCCCTTCCCTAATCGTGACAGCAACACGGTGAGTCATTACGGCCTTGCTGTCACCGTCCTTGTCCAAATTACTCAG
TACTGTCGCTATCTCGAGATTATCGGCAAGGACGCGCACCGTCGTGTTCTTGATAGTGTCCAGAGCGGCGGTGTGCAGGG
ATTTTGCGTCGGCTTTCTGAGCACAGTGGCTGTGGCCAGTTCAGACGACGAGAGTAACCTTGGCACGTTGGCTGCCGTTG
CTCTTCGACTGGCCGTGTGCATCGGCGCCTACGTTGACGCAGATGGGGCGAGAAATGCAGACGACTATATGTCTGTTGCT
GTTCGATGGCAGGACGAGAATGACGAGGACAAGGAGAAAGTAGCCGGCATCGTACAGTCGATCCCTGGTGTACGTCCATT
CACCACAGTATTTCAGACCAGAATACGGAGTACATACTAATACTATGTTGATGCTGTATTAGGCCTACATCTCCAGTCTC
AACGACTATTCTAACCTGACGGTTACGATTCGGGCATCTAGTCTTGGCGTTTTGGAGGAGGAAGCCACGCGAAAGAACCT
GCGAATCAAAGACGTTCATGTCCATGGCCGTTTCCATACGGTTGATCATTCGTCGGCTGTGGATAAGATACTGGCCTTCT
CCCAGCTCTCAGACGGATTGTCATTCCCGGAGCCATCACGACTGCAGGATCCGATCCGGAACACGGCCGATGGAGGGATC
CTCCCAGACGGATCTCCCCTGACTCGAATCTCCCTGGAGAGCGCAATGGTGAATGTCGCCGATTGGTATGCGACCATGAA
GCTCGCCATCCAGCAGCTTCCAAAGTCCGAACGAACGGTGGCTGTAGCCGGGTTCGGAAGCGGGATTCCTGCTTCGCTGA
CGCGGGATACACATCTCCAAGTGCTGTCTCTGGCAAAACTGGACACGCAGAAGCCGAAGCTTAACGGATTTCAGGGCACG
GAGCCGTATGACCCACAGTCCAGCTATCCCCCCCACTCCATCGCTATTGTCGGCATGGCCGGTCGCTTTCCAGGGGCAGA
TTCGGTCGACGAGCTCTGGGACCTGCTCATGCAGGGCAAGACGATGGTCCAGCCGGCACCGGTCGAGCGCCTCGGGCTGC
CGCAGACCGGCGATCACGCCAACACAAAGTGGTGGGGCAACTTTCTGGACAACCCGGAGACGTTTGATCACAAGTTCTTC
AAGAAGTCGTCTCGCGAGGCTGTGGCCTGGGATCCGCAGCAACGGCTCTTGCTCGAGGTCATCTATGAGGCCCTGGAATC
GTCGGGCTACTTCGGGGCCTCAGCATCCCCAGAGCCTGTCGACTACGGCCGCTACATTGGCGCTGTGATGAACAACTACT
ACGACAATCTCTCGTGCCACGCCGGCACCGCTTATGCCACTGTCGGCACCTCGCGCTGCTACCTCAGCGGCTGCATGAGC
CATTACTTTGGCTGGACGGGGCCGGCCCTGACTATCGACACGGCCTGCTCGTCTTCTCTCGTCGCCATCCACACGGCCTG
CCGAGCCATCTGGTCTGGGGAATGCTCCCGTGCTGTCGCTGGCGGGACAAATGTTATTTCAAGTCCGTTTGACTACCAGA
ACCTCTCTGCTGCCGGCTTTCTTAGCCCATCGGGGCAGTGCAAGCCGTTTGACGCAGATGCCGACAGCTACTGTCGGGGG
GAAGGCGTCGCGGTCGTGGTGCTAAAACCCCTTGCTGATGCGGTCGAGAACGGAGACAAAATCCTGGGTGTCATTGTCGG
GTCGGCGGCCAACCAGAATCACAATGTCGGCCCCATCACGGCACCGCACTCGACATCGCAGGCGAATCTGTACAAAAAGG
TGCTGAGTCTTGGCCGCGTCAGGCCGGAAGATGTGTCTTATGTCGAGGCGCACGGAACAGGGAGTATGATATGCCGCCCT
ACTGATTGAGATGTTCAGCCTTACTGACCGTTGCAGCCGGAGTCGGAGACCCGATCGAGGTCGCCAGTATCCGAGAAGCC
TTTGGAGTTGACCGGCAGTCGGTGCTCCACTTTGGCTCCATCAAAGGCAACATCGGCCATACCCAAGCCACAGCCGGAGT
GGCTGGTCTTATTAAAGTTCTCTTGATGATGAGGCACCGCACAATACCCTCCCAGGCCAGCCGCAAGTCTCTGAACCCCA
AGATTACGGCCTTTGACCCAACGACAATGGCCATCCCACGCCAGACTATTCCTTGGCAAGCCTCGACGTTTCTTGCCCTT
GTCAACAGCTACGGTGCAGCCGGGAGCAACTCGGCTGTCTTGATCCGGGAAGGCCCATCAGCGACGAGCACGGAAAACTC
CCCCCAGTTGTCTAGGTACCCGCTGTTCATCTCTGCCGGGTCACCCAATGGCCTTGCCGCATACTGCAAGAAATTTCTGG
ATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62