GenePrediction:GLEAN_3972 Details

Name: GLEAN_3972
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2004006..2008884 (+ strand)
Length: 4879
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2004006..2004659 (+ strand)
Length: 654
Type: CDS
Source: GLEAN
Position: GCSC_113:2004706..2005209 (+ strand)
Length: 504
Type: CDS
Source: GLEAN
Position: GCSC_113:2005315..2007573 (+ strand)
Length: 2259
Type: CDS
Source: GLEAN
Position: GCSC_113:2007688..2007901 (+ strand)
Length: 214
Type: CDS
Source: GLEAN
Position: GCSC_113:2007959..2008884 (+ strand)
Length: 926
>GLEAN_3972 class=GenePrediction position=GCSC_113:2004006..2008884 (+ strand)
ATGCTGGCCACGACTGTCAGCAGTATTGGCGATCTCGAAGCCAAGCTTTCAACGGCTGTGACGGGTTCTCTGACGGCCAC
CCCGGAAGCACAGCCCGTGGTGCTTGTCTTTGGGGGCCAGGAGAGCGATTTTGTTGGCATATCAGAAAACCTGTACCGGT
CCTGCAAAGTTTTCCGCCAGAACGTGGATGCTGTTGATGCCCTTGTCGTCACCAGCGGTCAGGATAGCATCCTCCCCGCC
GTCTTCCAACGTGAGCCGCCAAGCCGCTTAGTCAGCCTTCACACTGCCCTGTTCGCGGTCCAGTACGCATCGGCCAAGTC
TTGGATGGACTGCGGACTACGTGTGGATGCCGTTATCGGGCACAGCTTTGGCCAACTGACGGCACTGTGCATCTCCGGTG
TTCTGTCACTGTCAGATGCCGTCAAACTGGTATCCGGGAGGGCATTACTGATGCAGGAGCACTGGGGCCTTGAGCCCGGG
TCTATGCTGGCTTTGCAGACTGACCGGAAAACGGTGCAGGAGCTGCTGGCTAAGTTGGACGATACGCTTTATGCTGAGAT
TGCATGCTACAATGGACCCAAGAGTCATGTTGTCGTGGGGGCCATCGACGCTCTCCAGAAGGACATTTCGGACTCGCCCC
GTCTTTGTGCTTCCGTTCGCACCAAAATAATTGAGCGTCACACATGGGTTCCACTCCCAGTTCACGCATCCGCTATTGTC
ACACCTCGCCGCGCTCGCAGGAGAACTGGAATGGAAGCGCCCGGCGATCCATCTGGAGACGACAGACGAGCTGGAGAGCA
TTGCCGAGCCTGACTTCAGCATCGTTGCCGGACACACAAGGCTCCCGGTTTTCTTCCAAAACGCCGTCCAGAGGCTCACG
GAAAAGTTTCATCGCTGCACATGGATTGAGGCGGGCCGTGGTGACTCCGTCCTCCAGCTCGTCAAAGCGTCCATAACCAA
CACACAAGGCCATGTCTTCCACTCTCCTCCGCTCACGTCCACCGCTGCGGAACATGCACTTGTGGACATCACCGTTGACC
TTTGGAACAGAGGGTACTCGACACAGTACTGGCCGTTCCATCGGAGCGAGAAGTGTATGTACGGCGACCTCGATCTTCCT
TCTATCCAGTTCGACAAGACTCGTTATTGGCTTGGCTTTCAGAGAAGGGCTACCGAGAAGGCAGACGGAGAAGCAGCTCT
TCAAGTGAAGGAAGCGGTCCACGAGCTCCTCTCCTTCCTCCGGTTCCAAGATGGCGCCAAAACCGAAGCTGTGTTCCAGA
TAGACCCTCATGCTGAGAGATTCTAGAAGCTTCTGGGAGGACACGTCATGGGTGGCCAGACGCTTGCCCCGGCCTCTCTG
TACTTTGAGGTTGTTGCTCACGCCGCCTTGTTCCTCCAGGGTGATTCCAAAGCGGAGTTTCATGTGCTGGTCGTTGACGA
TCTGCACATGCAGACGCCCATCGGTCAAGATGTTAACACCAAGGTGTTCCTTGTGTTGAAGAGGCTCCACGATAGCGAAC
GTCTTGCGTGGTCCTTCAGTTTCAAAACACAGCCGTGCGAAGCGCCCAACGCTGAGCCGTTTGAGGTATCGACGGGCCGT
GTCTGTCTTCGGCTCCGCAACGACAAGCAACAGGCCCGTGACTTTGAGCGGTATGAGAGCCTGACGGGCCATCGCAGATA
CGAACAGGTGGTGCACCATCCCGAAGCCGACAAGATGCAGGGCCGACACATCTACCGTGCCTTCAACACGGTCGTGTTCT
ACGACAAGCCGTTTCACGGGATCAAGGAAGTGGCGAGTGTCGGATTCGAGGCGGCCGGCAAGGTGAGGGCGATGCCCAGT
CCCGACGATCCGGCGGACCAACGCCTCGTCGACACGCCTATGATAGACAGCTTCATGCAGTTTGCCGGCTTCTTGGTGAA
CTACTTCAACAACCCGAGCAGTGAGGACGTGTTCGTCTGCGGAAAGATTGAGCACATCGAACTGGGCGGCAACTTCGATC
CTGACGCCGGCGAGTGGCTCGTGTACGCCACCATGGGCGAAGGGGGCGAAACCGACGCCTGGTCAGATGCGTACATCTTT
GACGCCCGAACCAAGAAAATGGTCATGGCCGCGTTTGGCTTCCGCTTCTCCCGGATATCCAGGACGCTTCTCGGCCGGAT
CTTGAAAAACGTGAACAAGTCTGCCAATGCAACCGAATCAACGGCGCAGGTCGACAACCTCGTCCCTGTGAAACACACAC
GTTCGGCAGCATTGGCTTCTCGAGCGAACCAGCCTGCAGGAAAAAAGCGGGAGCTCCTTAAGGTCCTGTCGAATGTGACA
GACGTCCCGGTCGAAGACATTGGGGATGAGTCCACACTGGACGATCTCGGCATTGACTCCCTGATGGCTACGGAGGTTCT
CAACGACATCCGTGCCGCTTTGGGCCTGACGATTGACCTGTCAATCTTCTTGTTCACCCCCAATATAGCAGCCTTGACGT
TGCTTGTGAACGAGAAGCTGGGAACATGCGAGGATAGTGACGCGGACTCGGGGATTTCGGGGGTTTCGGGAGTTTCGAGA
AATTCCGATGCGGGACCCGAGACACCTTCCAAAGATGAGTCGTCGCAGCCGAAGTCGCCGATCCTGTCTGCCCGCGACGC
ATTCGACGAGACGCGGCTCAACTACGACCAACACGCCAAGACCACCGGAGCTGTGGGCTTTTGGCAGTATGCCTACCCTT
CCCAGGCGCGCCTGGTCCAGGCCTACATTATCGAGGCCTTTGCGGCCCTAGGCTGCGACCTTAGAACACTCGCGGCTGGC
GACGAGGTGCTGCCCGTGAAAAGCCTCAGCAAGCATGCCCAGCTCACACTTCAGTTCCACCGTGCCCTTGAAGATGGCGG
CCTCATCATCGCACACACAAACGGCTCTTTTGCCCGGACCGCACGTGACATCGATCCCACTCCCGCAGAGCAAATCTACC
AGGACAGCATATTTCATCATCCCCAGCATGCGAGCGTCCTAAAGCTTGTCCGAGCTGTCGGCTCGGAATTGGCAGCATGT
CTCAGTGGCAACAAGGAGGGAATTCAGGTCGTCTTTGGCAACCGAGACACAAAGAAGACGCTTGAAGAGATGTACGAGTT
CTGGCCGCTGCTCCGAACGCCCACTCTTGTTCTGGGCGATTTCCTGGAAAAGGCCAGCAGAAACGTTGCCGGGCACAGAA
AATTTCGCATTCTGGAGATCGGCGCGGGCACCGGAGGCACGGCGCGGTATCTTCTCCAACACCTGCGAAATCTTCACATC
GACTTTGAGTACGTCTTTACCGACCTGGGCGCTTCGCTGGTCAATGCGGCCTCCAAGAGCTTCAAGGGCCACGAGGCAGG
TGGCGATCTGGCATTCGACGTGCTGGACATTGAAAAAGAGCCCAATATCGAGTACAAGGGCCGGTTCGACGGGGTCATAG
CAACCAACTGCATCCATGCCACGCGCGACCTGGGCGTATCGCTTCGACACGCGAGGCAAATGCTTCGCGACGACGGGGCC
CTTGCGCTTGTCGAGATCACGCAGAATATGTACTGGCTCGACGTTGTCGTAGGCCTCTTCGACGGTTGGTGGTTGTTCGA
AGACGGGAGACAGCACGCCCTCATCGACGAGAGACACTGGGAGAAGAGAATGAAGGAAGCAGGCTTCGGCCATGTCTCCT
AGAGCGATGGCACCTGCCCGGAAGCCGCGACCGTCAGAGTCATTGCGGCTTTTCCGGGCACGGATGGTGATGAGCTTGCA
GTCGTGCCCGAACGGCAGGTCAAGGCGGCCATAGAGACGGTTGTGTACAAGACAATCGGAGACATGGACATCCATGCCGA
TATCTACTACCCCCTTGAGGGCGAGCAGGTGCTATGGGGAAGAAAACTGCCTGTCGGTGTGTACTAAGTTGAACACCCTC
CATCCGGACGTCTCATACTGACGGTGCGAACAGCTTTGATGATCCACGGCGGAAGCCACATGCTCTTCAGCAGAAAAGAC
GTACGACCCGCCCAGACTCGCCTCTTGCTTAATCGTGGATTCTTGCCCGTCAGCATAGACCACCGGCTCTGTCCCGAGGT
CGGTCTCCAAGATGGGCCCATGGTCGACGTATGCGACGCCTACGACTGGGCGCGCAACACGCTCTCCAAGATCCGACTTC
CAAACCCCGGCCTCCAGGTAGACGGCGAGAAAGTGTTCGTCGTCGGATGGTCCTCGGGTGGACAGCTGGCCATGTCACTT
GGCTGGACGGCACCACAGCGCGGCCTGCCACCTCCAGTGGCCATGATCGTCTTCTACGCGCCAACCGATTACGAGGATGC
CTGGTGGCAGAGCCCGATCGAGCCCAATGGGGCGCCGTACCAGGGGCAGCAGTACGATGTCCTCGAAGGCGTCCGGGACA
AGCCCATTTCTCAATACGACACGGTGGTTGCATGGGAGGAGCTCCTCACATACCCGCGCAACTTGCTCGATGCCCGCTGC
CGCATCGTCATGCACATCAACTGGAAGGCGCAGACGCTTCCCGTGATTCTGAACGGGTTGCCTAGCAAGAAACGAGCACT
GGCTGCCTTTGCAGAGGAGCAAGACTGGGGTAAGCTGCCGCAGCCGCCCCTCGACGTGATCCGAGCGGCAAGCCCGAGAG
CACACATCCGCAATGGCAGCTTCAAGGTGCCGACCTTCTTTGTCCACGGCACCGCGGATGACCTGATTCCGTGGGAGCAA
GCCGCAGGCACCCATCGCACGATGTCTGAGCTGGGCCTCGAGTCCGAGATGGTCCTGGTCGACGGTGCGCCGCACATCTG
CGATCTAAGCAGCGATCCAAAGTCAGATGGATGGAAAGCTGTTTTGCGAGCGTACAATTTCCTTGCTTCGCATATTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62